Previous Contig 011760:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020H22Sequence784011760 (7)gb:AC104272_17373592e-65Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMFF034K08Sequence651011760 (7)gb:AC104272_17373597e-66Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMFF038K10Sequence778011760 (7)gb:AC104272_17373591e-65Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMFF042P11Sequence641001829 (2)gb:AY128312_15806111e-27Arabidopsis thaliana unknown protein (At1g80950) mRNA, complete cds.>gb:BT003346473011760 (7)gb:AC104272_17373597e-16Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMFF046P01Sequence600011760 (7)gb:AC104272_17373593e-74Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s344021772
JMSF013N20Sequence441001829 (2)gb:AY128312_15806112e-17Arabidopsis thaliana unknown protein (At1g80950) mRNA, complete cds.>gb:BT003346755011760 (7)gb:AC104272_17373592e-19Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMSF046D03Sequence456007876 (2)gb:AP005554_18539871e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11667011760 (7)gb:AC104272_17373591e-74Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046P01- TCAGTTAGCTTTTC
                      ____________________________________________________________
consensus TCAGTTAGCTTTTC
 
. : . : . : . : . : . :
JMFF046P01- TAGAATTGGTTTGCCATTGTTTCTGTCTGTTACATCTCTTTACTACTTTACTTGACTGTG
                      ____________________________________________________________
consensus TAGAATTGGTTTGCCATTGTTTCTGTCTGTTACATCTCTTTACTACTTTACTTGACTGTG
 
. : . : . : . : . : . :
JMFF046P01- GTCCCCGTGTATATTGTTGAAGAGATCAGTGGCTAAGCTTCCTCTGGTTGGTCTTATCAG
rJMSF046D03+ TCTTATCAG
                      ____________________________________________________________
consensus GTCCCCGTGTATATTGTTGAAGAGATCAGTGGCTAAGCTTCCTCTGGTTGGTCTTATCAG
 
. : . : . : . : . : . :
JMFF046P01- CAAGTGCCTTGGTTGTGTATATGTCCAGCGGGAGTCTAGATCTCCTGAGTTCAAAGGTGT
rJMSF046D03+ CAAGTGCCTTGGTTGTGTATATGTCCAGCGGGAGTCTAGATCTCCTGAGTTCAAAGGTGT
rJMFF034K08+ CTGAGTTCAAAGGTGT
rJMFF038K10+ CTGAGTTCAAAGGTGT
rJMFF020H22+ AGTTCAAAGGTGT
                      ____________________________________________________________
consensus CAAGTGCCTTGGTTGTGTATATGTCCAGCGGGAGTCTAGATCTCCTGAGTTCAAAGGTGT
 
. : . : . : . : . : . :
JMFF046P01- CTCAGGTGTGGTAAATGAAAGGATCAAGGAAGCTCATCAGGATGAATTAGCCCCAAAGAT
rJMSF046D03+ CTCAGGTGTGGTAAATGAAAGGATCAAGGAAGCTCATCAGGATGAATTAGCCCCAAAGAT
rJMFF034K08+ CTCAGGTGTGGTAAATGAAAGGATCAAGGAAGCTCATCAGGATGAATTAGCCCCAAAGAT
rJMFF038K10+ CTCAGGTGTGGTAAATGAAAGGATCAAGGAAGCTCATCAGGATGAATTAGCCCCAAAGAT
rJMFF020H22+ CTCAGGTGTGGTAAATGAAAGGATCAAGGAAGCTCATCAGGATGAATTAGCCCCAAAGAT
                      ____________________________________________________________
consensus CTCAGGTGTGGTAAATGAAAGGATCAAGGAAGCTCATCAGGATGAATTAGCCCCAAAGAT
 
. : . : . : . : . : . :
JMFF046P01- TATGCTTTTTCCAGAGGGCACAACAACAAATGGGGATTTTCTCCTTCCATTCAAGACTGG
rJMSF046D03+ TATGCTTTTTCCAGAGGGCACAACAACAAATGGGGATTTTCTCCTTCCATTCAAGACTGG
rJMFF034K08+ TATGCTTTTTCCAGAGGGCACAACAACAAATGGGGATTTTCTCCTTCCATTCAAGACTGG
rJMFF038K10+ TATGCTTTTTCCAGAGGGCACAACAACAAATGGGGATTTTCTCCTTCCATTCAAGACTGG
rJMFF020H22+ TATGCTTTTTCCAGAGGGCACAACAACAAATGGGGATTTTCTCCTTCCATTCAAGACTGG
                      ____________________________________________________________
consensus TATGCTTTTTCCAGAGGGCACAACAACAAATGGGGATTTTCTCCTTCCATTCAAGACTGG
 
. : . : . : . : . : . :
JMFF046P01- TGCTTTTTTGTCAAAAGCTCCAGTACTTCCTGTCATTTTAAGATATCCATACCAAAGATT
rJMSF046D03+ TGCTTTTTTGTCAAAAGCTCCAGTACTTCCTGTCATTTTAAGATATCCATACCAAAGATT
rJMFF034K08+ TGCTTTTTTGTCAAAAGCTCCAGTACTTCCTGTCATTTTAAGATATCCATACCAAAGATT
rJMFF038K10+ TGCTTTTTTGTCAAAAGCTCCAGTACTTCCTGTCATTTTAAGATATCCATACCAAAGATT
rJMFF020H22+ TGCTTTTTTGTCAAAAGCTCCAGTACTTCCTGTCATTTTAAGATATCCATACCAAAGATT
                      ____________________________________________________________
consensus TGCTTTTTTGTCAAAAGCTCCAGTACTTCCTGTCATTTTAAGATATCCATACCAAAGATT
 
. : . : . : . : . : . :
JMFF046P01- TAGCCCTGCCTGGGAGTCTATATCTGGGTCGCGGCATGTGCTGTTGCTTCTCTGTCAATT
rJMSF046D03+ TAGCCCTGCCTGGGAGTCTATATCTGGGTCGCGGCATGTGCTGTTGCTTCTCTGTCAATT
rJMFF034K08+ TAGCCCTGCCTGGGAGTCTATATCTGGGTCGCGGCATGTGCTGTTGCTTCTCTGTCAATT
rJMFF038K10+ TAGCCCTGCCTGGGAGTCTATATCTGGGTCGCGGCATGTGCTGTTGCTTCTCTGTCAATT
rJMFF020H22+ TAGCCCTGCCTGGGAGTCTATATCTGGGTCGCGGCATGTGCTGTTGCTTCTCTGTCAATT
                      ____________________________________________________________
consensus TAGCCCTGCCTGGGAGTCTATATCTGGGTCGCGGCATGTGCTGTTGCTTCTCTGTCAATT
 
. : . : . : . : . : . :
JMFF046P01- TATAAACTATATGGAAGTTATCTGGTTACCCGTTTACTGTCCCTCACAACAAGAAAAGGA
rJMSF046D03+ TATAAACTATATGGAAGTTATCTGGTTACCCGTTTACTGTCCCTCACAACAAGAAAAGGA
rJMFF034K08+ TATAAACTATATGGAAGTTATCTGGTTACCCGTTTACTGTCCCTCACAACAAGAAAAGGA
rJMFF038K10+ TATAAACTATATGGAAGTTATCTGGTTACCCGTTTACTGTCCCTCACAACAAGAAAAGGA
rJMFF020H22+ TATAAACTATATGGAAGTTATCTGGTTACCCGTTTACTGTCCCTCACAACAAGAAAAGGA
rJMSF013N20+ TTACTGTCCCTCACCACAAGAAAAGGA
                      ____________________________________________________________
consensus TATAAACTATATGGAAGTTATCTGGTTACCCGTTTACTGTCCCTCACAACAAGAAAAGGA
 
. : . : . : . : . : . :
JMFF046P01- TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
rJMSF046D03+ TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
rJMFF034K08+ TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
rJMFF038K10+ TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
rJMFF020H22+ TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
rJMFF042P11+ TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
rJMSF013N20+ TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
                      ____________________________________________________________
consensus TGATCCAAAGCTTTATGCAGAGAATGTCCGAAGACTAATGGCTCGTGAGGGTAATATGAT
 
. : . : . : . : . : . :
JMFF046P01- AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCT
rJMSF046D03+ AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCTCTCAATGGTAATAA
rJMFF034K08+ AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCTCTCAATGGTAATAA
rJMFF038K10+ AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCTCTCAATGGTAATAA
rJMFF020H22+ AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCTCTCAATGGTAATAA
rJMFF042P11+ AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCTCTCAATGGTAATAA
rJMSF013N20+ AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCTCTCAATGGTAATAA
                      ____________________________________________________________
consensus AATGTCAGATATTGGCTTGGCTGAGAAGCGAGTATATCATGCTGCTCTCAATGGTAATAA
 
. : . : . : . : . : . :
rJMSF046D03+ TAGCATGTCTACTGTTTATCATCAGAAAGACGAATGAATAATTTCATGGCATCGTCCTGA
rJMFF034K08+ TAGCATGTCTACTGTTTATCATCAGAAAGACGAATGAATAATTTCATGGCATCGTCCTGA
rJMFF038K10+ TAGCATGTCTACTGTTTATCATCAGAAAGACGAATGAATAATTTCATGGCATCGTCCTGA
rJMFF020H22+ TAGCATGTCTACTGTTTATCATCAGAAAGACGAATGAATAATTTCATGGCATCGTCCTGA
rJMFF042P11+ TAGCATGTTTACTGTTTATCATCAGAAAGACGAATGAATAATTTCATGGCATCGTCCTGA
rJMSF013N20+ TAGCATGTCTACTGTTTATCATCAGAAAGACGAATGAATAATTTCATGGCATCGTCCTGA
                      ____________________________________________________________
consensus TAGCATGTCTACTGTTTATCATCAGAAAGACGAATGAATAATTTCATGGCATCGTCCTGA
 
. : . : . : . : . : . :
rJMSF046D03+ AATGACACCAAGTAGTCAGATCCTACTTGCAGTGTTTGTCATGAATATAATTGAACATGT
rJMFF034K08+ AATGACACCAAGTAGTCAGATCCTACTTGCAGTGTTTGTCATGAATATAATTGAACATGT
rJMFF038K10+ AATGACACCAAGTAGTCAGATCCTACTTGCAGTGTTTGTCATGAATATAATTGAACATGT
rJMFF020H22+ AATGACACCAAGTAGTCAGATCCTACTTGCAGTGTTTGTCATGAATATAATTGAACATGT
rJMFF042P11+ AATGACCCCAAGTAGTCAGATCCTACTTGCAGTGTTTGTCATGAATATAATTGAACATGT
rJMSF013N20+ AATGACACCAAGTAGTCAGATCCTACTTGCAGTGTTTGTCATGAATATAATTGAACATGT
                      ____________________________________________________________
consensus AATGACACCAAGTAGTCAGATCCTACTTGCAGTGTTTGTCATGAATATAATTGAACATGT
 
. : . : . : . : . : . :
rJMSF046D03+ GTGCTATTTATCTATGCTAAAACAATAAAAACTTCGTCATTTGATGACC
rJMFF034K08+ GTGCTATTTATCTATGCTAAAACAATAAAAACTTCGTCATTTGATGACCAAGTATTTCTG
rJMFF038K10+ GTGCTATTTATCTATGCTAAAACAATAAAAACTTCGTCATTTGATGACCAAGTATTTCTG
rJMFF020H22+ GTGCTATTTATCTATGCTAAAACAATAAAAACTTCGTCATTTGATGACCAAGTATTTCTG
rJMFF042P11+ GTGCTATTTATTTATGCTAAAACAATAAAAACTTTGTCATTTGATGACCAAGTATTTTTG
rJMSF013N20+ GTGCTATTTATCTATGCTAAAACAATAAAAACTTCGTCATTTGATGACCAAGTATTTCTG
                      ____________________________________________________________
consensus GTGCTATTTATCTATGCTAAAACAATAAAAACTTCGTCATTTGATGACCAAGTATTTCTG
 
. : . : . : . : . : . :
rJMFF034K08+ TAACGTATGCTAACAAATGCCCATTTTA
rJMFF038K10+ TAACGTATGCTAACAAATGCCCATTTTATGACAAGTACATTGATGCTGCTGTTGAAAACT
rJMFF020H22+ TAACGTATGCTAACAAATGCCCATTTTATGACAAGTACATTGATGCTGCTGTTGAAAACT
rJMFF042P11+ TAACGTATGCTAACAAATGCCCCTTTTATGACAAGTACATTGATGCTGCTGTTGAAAACT
rJMSF013N20+ TAACGTATGCTAACAAATGCCCATTTTATGACAAGTACATTGATGCTGCTGTTGAAAACT
                      ____________________________________________________________
consensus TAACGTATGCTAACAAATGCCCATTTTATGACAAGTACATTGATGCTGCTGTTGAAAACT
 
. : . : . : . : . : . :
rJMFF038K10+ ATTCTGTTGAAATATTTTGGTATGTGTAAACAGAAAGTCTTTTGTGGCTCTTTTTTAACT
rJMFF020H22+ ATTCTGTTGAAATATTTTGGTATGTGTAAACAGAAAGTCTTTTGTGGCTCTTTTTTAACT
rJMFF042P11+ ATTTTGTTGAAATATTTTGGTATGTGTAAACAGAAAGTCTTTTGTGGCTCTTTTTTAACT
rJMSF013N20+ ATTCTGTTGAAATATTTTGGTATGTGTAAACAGAAAGTCTTTTGTGGCTCTTTTTTAACT
                      ____________________________________________________________
consensus ATTCTGTTGAAATATTTTGGTATGTGTAAACAGAAAGTCTTTTGTGGCTCTTTTTTAACT
 
. : . : . : . : . : . :
rJMFF038K10+ CAATATACCGTGTGATGGTATCTTGGTAGTTGTGCAAAACC
rJMFF020H22+ CAATATACCGTGTGATGGTATCTTGGTAGTTGTGCAAAACCAATACAACGG
rJMFF042P11+ CAATATACCGTGTGATGGTATTTTGGTAGTTGTGCAAAACCAATACAACGG
rJMSF013N20+ CAATATACCGTGTGATGGTATCTTGGTAGTTGTGCAAAACCAATACAACGGGACAGTTGA
                      ____________________________________________________________
consensus CAATATACCGTGTGATGGTATCTTGGTAGTTGTGCAAAACCAATACAACGGGACAGTTGA
 
. : . : . : . : . : . :
rJMSF013N20+ ATTTGAGTTGGCGGGAGCATCTGTGTATGAAGTGTTTAGTCAGACAGAAAGAGTCGTTTA
                      ____________________________________________________________
consensus ATTTGAGTTGGCGGGAGCATCTGTGTATGAAGTGTTTAGTCAGACAGAAAGAGTCGTTTA
 
. : . : . : . : . : . :
rJMSF013N20+ TGAAGTCTTTTGGGGAATCCATCTGAAGTGTGTGTTTTTGGTGTTCCTGCAGGTCTCTTT
                      ____________________________________________________________
consensus TGAAGTCTTTTGGGGAATCCATCTGAAGTGTGTGTTTTTGGTGTTCCTGCAGGTCTCTTT
 
. : . : . : . : . : . :
rJMSF013N20+ ATTCAACAGTAATTCAAGTTCACCATCTGTATATTCATGTATGATGTTATTGACTAGGAA
                      ____________________________________________________________
consensus ATTCAACAGTAATTCAAGTTCACCATCTGTATATTCATGTATGATGTTATTGACTAGGAA
 
. : . : . : . : . : . :
rJMSF013N20+ AAGCAAAAGTAAATTGCTGGAACCCTTGCGCGGTTGAGGGATTCTTATTGTTCATATTAC
                      ____________________________________________________________
consensus AAGCAAAAGTAAATTGCTGGAACCCTTGCGCGGTTGAGGGATTCTTATTGTTCATATTAC