Previous Contig 011758:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013M18Sequence472005427 (2)gb:AY150481_15850466e-21Arabidopsis thaliana unknown protein (At4g08540) mRNA, complete cds.726011758 (2)gb:AY150481_15850465e-46Arabidopsis thaliana unknown protein (At4g08540) mRNA, complete cds.
JMSF052N06Sequence659005427 (2)gb:AY150481_15850465e-52Arabidopsis thaliana unknown protein (At4g08540) mRNA, complete cds.933011758 (2)gb:AY150481_15850462e-89Arabidopsis thaliana unknown protein (At4g08540) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052N06+ TAANGTATGTGCTCCTGCACTTCATAACTCAG
                      ____________________________________________________________
consensus TAANGTATGTGCTCCTGCACTTCATAACTCAG
 
. : . : . : . : . : . :
rJMSF052N06+ GATTTGCGGGTTCATGNTCTCGAATATGGCAGCGAGATTCTTATTGGGATGCACGCCCAT
                      ____________________________________________________________
consensus GATTTGCGGGTTCATGNTCTCGAATATGGCAGCGAGATTCTTATTGGGATGCACGCCCAT
 
. : . : . : . : . : . :
rJMSF052N06+ CGTCTAGAAGTGGTGAATACCCTCTTTTTATTCCTCGCCAAAATTTTTGCTCTACTGGTG
                      ____________________________________________________________
consensus CGTCTAGAAGTGGTGAATACCCTCTTTTTATTCCTCGCCAAAATTTTTGCTCTACTGGTG
 
. : . : . : . : . : . :
rJMSF052N06+ GAGAAACTTCGTGGTCTGAAAAAAGCTCAAGTAACTTTGGTGTGGCTTCTATGGAGTCTG
                      ____________________________________________________________
consensus GAGAAACTTCGTGGTCTGAAAAAAGCTCAAGTAACTTTGGTGTGGCTTCTATGGAGTCTG
 
. : . : . : . : . : . :
rJMSF052N06+ ATAGGAAGGCTCGCTTGGATTCTTCTGGTAGCAGCAGTTTCAATTATTCTTCTGCTTCAC
                      ____________________________________________________________
consensus ATAGGAAGGCTCGCTTGGATTCTTCTGGTAGCAGCAGTTTCAATTATTCTTCTGCTTCAC
 
. : . : . : . : . : . :
rJMSF052N06+ CACACTCACTTGAAACACACAAGGAGTTACAGAAAGGGATAGCACTTCTCAAGAAAAGTG
rJMSF013M18+ AAAGTG
                      ____________________________________________________________
consensus CACACTCACTTGAAACACACAAGGAGTTACAGAAAGGGATAGCACTTCTCAAGAAAAGTG
 
. : . : . : . : . : . :
rJMSF052N06+ TTGCTTGCGCAACAACATACTGTTATAACATATTATGCCTAGACGTTCCTGCAGAGGCTT
rJMSF013M18+ GTGCTTGCGCAACAACATACTGTTATAACATATTATGCCTAGACGTTCCTGCAGAGGCTT
                      ____________________________________________________________
consensus TTGCTTGCGCAACAACATACTGTTATAACATATTATGCCTAGACGTTCCTGCAGAGGCTT
 
. : . : . : . : . : . :
rJMSF052N06+ CTACTTTTGAAGCATTTGCAAGGTTGTTGACTACCCTTTCTTCTTCCAAGGAAGTCCGAT
rJMSF013M18+ CTACTTTTGAAGCATTTGCAAGGTTGTTGATTACCCTTTCTTCTTCCAAGGAAGTCCGAT
                      ____________________________________________________________
consensus CTACTTTTGAAGCATTTGCAAGGTTGTTGATTACCCTTTCTTCTTCCAAGGAAGTCCGAT
 
. : . : . : . : . : . :
rJMSF052N06+ CTGTATTTTCTTTAAAAATGGCTTGTTCAGGGTCATCCAAGCAAGTCCAACAATTCAGCA
rJMSF013M18+ CTGTATTTTCTTTAAAAATGGCTTGTTCAGGGTCATCCAAGCAAGTCCAACAATTCAGCA
                      ____________________________________________________________
consensus CTGTATTTTCTTTAAAAATGGCTTGTTCAGGGTCATCCAAGCAAGTCCAACAATTCAGCA
 
. : . : . : . : . : . :
rJMSF052N06+ GATCTGTGTGGGATGTAAATTCATTAGTTTCCTCAAGTGCTATGATAGAAAGTGTGCATG
rJMSF013M18+ GATCTGTGTGGGATGTAAATTCATTAGTTTCCTCAAGTGCTATGATAGAAAGTGTGCATG
                      ____________________________________________________________
consensus GATCTGTGTGGGATGTAAATTCATTAGTTTCCTCAAGTGCTATGATAGAAAGTGTGCATG
 
. : . : . : . : . : . :
rJMSF052N06+ CGTTGCAAGCACAAAGAAACATATTTGACCATAATCTTCCAAGTTCTACAGCCAGTTTGC
rJMSF013M18+ CGTTGCAAGCACAAAGAAACATATTTGACCATAATCTTCCAAGTTCTACAGCCAGTTTGC
                      ____________________________________________________________
consensus CGTTGCAAGCACAAAGAAACATATTTGACCATAATCTTCCAAGTTCTACAGCCAGTTTGC
 
. : . : . : . : . : . :
rJMSF052N06+ TTTACGCCAATGAAATATCCGACCTAGGAAGGAATGAAAATTTAATCGAGGGTTGGGATC
rJMSF013M18+ TTTACGCCAATGAAATATCCGACCTAGGAAGGAATGAAAATTTAATCGAGGGTTGGGATC
                      ____________________________________________________________
consensus TTTACGCCAATGAAATATCCGACCTAGGAAGGAATGAAAATTTAATCGAGGGTTGGGATC
 
. : . : . : . : . : . :
rJMSF052N06+ TAATCGAGCACCCCACTTTTCCTCCTCCGCCTTCACAAACCGAAGATGTTGAGCATTGGA
rJMSF013M18+ TAATCGAGCACCCCACTTTTCCTCCTCCGCCTTCACAAACCGAAGATGTTGAGCATTGGA
                      ____________________________________________________________
consensus TAATCGAGCACCCCACTTTTCCTCCTCCGCCTTCACAAACCGAAGATGTTGAGCATTGGA
 
. : . : . : . : . : . :
rJMSF052N06+ CTCGGGCCATGTTCATTGATGCAACGAAAAAGTGACTTCATAGCTTCATCGCTGACTGCC
rJMSF013M18+ CTCGGGCCATGTTCATTGATGCAACGAAAAAGTGACTTCATAGCTTCATCGCTGACTGCC
                      ____________________________________________________________
consensus CTCGGGCCATGTTCATTGATGCAACGAAAAAGTGACTTCATAGCTTCATCGCTGACTGCC
 
. : . : . : . : . : . :
rJMSF052N06+ CTTCAATTCCTGTAAATACAAGTAGTCCAGTGCACATAGAAGAAGCCGCATATCTCCTTC
rJMSF013M18+ CTTCAATTCCTGTAAATACAAGTAGTCCAGTGCACATAGAAGAAGCCGCATATCTCCTTC
                      ____________________________________________________________
consensus CTTCAATTCCTGTAAATACAAGTAGTCCAGTGCACATAGAAGAAGCCGCATATCTCCTTC
 
. : . : . : . : . : . :
rJMSF052N06+ CGTGCATTAAATGTATCCTAGTATTCAGTTTCTTTATGCTTTGGTTTTTCTCTCTGTGAT
rJMSF013M18+ CGTGCATTAAATGTATCCTAGTATTCAGTTTCTTTATGCTTTGGTTTTTCTCTCTGTGAT
                      ____________________________________________________________
consensus CGTGCATTAAATGTATCCTAGTATTCAGTTTCTTTATGCTTTGGTTTTTCTCTCTGTGAT
 
. : . : . : . : . : . :
rJMSF052N06+ T
rJMSF013M18+ TTACAATGTTGAACAGGAAAATGTATATTTGTCTGTGTTTCCCGTTCAAGACTGAAGAAA
                      ____________________________________________________________
consensus TTACAATGTTGAACAGGAAAATGTATATTTGTCTGTGTTTCCCGTTCAAGACTGAAGAAA
 
. : . : . : . : . : . :
rJMSF013M18+ TCCTTTTATAATTGCTTTTGACCATATATTTTATTACAAAACTAAAAGTGGGGAGGCCCG
                      ____________________________________________________________
consensus TCCTTTTATAATTGCTTTTGACCATATATTTTATTACAAAACTAAAAGTGGGGAGGCCCG