Previous Contig 011756:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013M05Sequence486013093 (2)723011756 (2)gb:AY054238_15630581e-42Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.
JMSF037E14Sequence635011756 (2)gb:AY054238_15630588e-49Arabidopsis thaliana AT4g05150/C17L7_70 mRNA, complete cds.732013093 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037E14+ CTAAACTCGCGAGGCCGGTCATCCAAA
                      ____________________________________________________________
consensus CTAAACTCGCGAGGCCGGTCATCCAAA
 
. : . : . : . : . : . :
JMSF037E14+ TTGTCGAAAAAATAATCCGGCGGGTCTGAAATGACGGAGGAAACCTCCGACCGTCCACGC
rJMSF013M05+ CGC
                      ____________________________________________________________
consensus TTGTCGAAAAAATAATCCGGCGGGTCTGAAATGACGGAGGAAACCTCCGACCGTCCACGC
 
. : . : . : . : . : . :
JMSF037E14+ TCCAAAACCGGTTCACAGTTAAGCGCGTCGATGAACCACTGCTCGCTCTTAGCCGAGCCG
rJMSF013M05+ TCCAAAACCGGTTCACAGTTAAGCGCGTCGATGAACCACTGCTCGCTNTTAGCCGAGCCG
                      ____________________________________________________________
consensus TCCAAAACCGGTTCACAGTTAAGCGCGTCGATGAACCACTGCTCGCTCTTAGCCGAGCCG
 
. : . : . : . : . : . :
JMSF037E14+ TCGAGAATGGAGGTGATGGCGGAAGCCGGCGTGGAGTGATCAGCTTCGTTAGGGAAAAGG
rJMSF013M05+ TCGAGAATGGAGGTGATGGCGGAAGCCGGCGTGGAGTGATCAGCTTCGTTAGGGAAAAGG
                      ____________________________________________________________
consensus TCGAGAATGGAGGTGATGGCGGAAGCCGGCGTGGAGTGATCAGCTTCGTTAGGGAAAAGG
 
. : . : . : . : . : . :
JMSF037E14+ AAGAGCCGCAACCGAGCCGACTTCTGAGCGGCGTGAACCAGCAGCCGGTCGTACTCCTCC
rJMSF013M05+ AAGAGCCGCAACCGAGCCGACTTCTGAGCGGCGTGAACCAGCAGCCGGTCGTACTCCTCC
                      ____________________________________________________________
consensus AAGAGCCGCAACCGAGCCGACTTCTGAGCGGCGTGAACCAGCAGCCGGTCGTACTCCTCC
 
. : . : . : . : . : . :
JMSF037E14+ ACCATGTTCTCCACGTCCTCGTCGGAAGTGACGGTGATGAGAGCGTCCAGGTCCTCGTTG
rJMSF013M05+ ACCATGTTCTCCACGTCCTCGTCGGAAGTGACGGTGATGAGAGCGTCCAGGTCCTCGTTG
                      ____________________________________________________________
consensus ACCATGTTCTCCACGTCCTCGTCGGAAGTGACGGTGATGAGAGCGTCCAGGTCCTCGTTG
 
. : . : . : . : . : . :
JMSF037E14+ GGGAGCTGGTATTTCAAGCACATATTCCCAAACCCCGACAGTTTTGACAGTTTGGCGACG
rJMSF013M05+ GGGAGCTGGTATTTCAAGCACATATTCCCAAACCCCGACAGTTTTGACAGTTTGGCGACG
                      ____________________________________________________________
consensus GGGAGCTGGTATTTCAAGCACATATTCCCAAACCCCGACAGTTTTGACAGTTTGGCGACG
 
. : . : . : . : . : . :
JMSF037E14+ AGGGACGAGAAGTTGGTTCGACGGTCCACCGCCACTATGCGGGTGTCGCCGCCGACGTAG
rJMSF013M05+ AGGGACGAGAAGTTGGTTCGACGGTCCACCGCCACTATGCGGGTGTCGCCGCCGACGTAG
                      ____________________________________________________________
consensus AGGGACGAGAAGTTGGTTCGACGGTCCACCGCCACTATGCGGGTGTCGCCGCCGACGTAG
 
. : . : . : . : . : . :
JMSF037E14+ CGCAGCTGATTGTCGAAAGGACGGGGGAGGATTTTCCCGCCGAAGCTGCACATCAAGCGC
rJMSF013M05+ CGCAGCTGATTGTCGAAAGGACGGGGGAGGATTTTCCCGCCGAAGCTGCACATCAAGCGC
                      ____________________________________________________________
consensus CGCAGCTGATTGTCGAAAGGACGGGGGAGGATTTTCCCGCCGAAGCTGCACATCAAGCGC
 
. : . : . : . : . : . :
JMSF037E14+ ACCGGCGGCGACGGTTGCGCTTGCATGGAGGCGGCGGCGCCGTCGTCTCGGTACGAGCGC
rJMSF013M05+ ACCGGCGGCGACGGTTGCGCTTGCATGGAGGCGGCGGCGCCGTCGTCTCGGTACGAGCGC
                      ____________________________________________________________
consensus ACCGGCGGCGACGGTTGCGCTTGCATGGAGGCGGCGGCGCCGTCGTCTCGGTACGAGCGC
 
. : . : . : . : . : . :
JMSF037E14+ GGAGTGGAAGTATTGGAACCATTCTCGGTTGCAAGATGGAGAGCCGCCATCACTGTAATT
rJMSF013M05+ GGAGTGGAAGTATTGGAACCATTCTCGGTTGCAAGATGGAGAGCCGCCATCACTGTAATT
                      ____________________________________________________________
consensus GGAGTGGAAGTATTGGAACCATTCTCGGTTGCAAGATGGAGAGCCGCCATCACTGTAATT
 
. : . : . : . : . : . :
JMSF037E14+ AGAATGT
rJMSF013M05+ AGAATGTGGAGGGAGAATCAAGAATATTGGGGTATATATATTGTAAAAATAGTGGGCTCA
                      ____________________________________________________________
consensus AGAATGTGGAGGGAGAATCAAGAATATTGGGGTATATATATTGTAAAAATAGTGGGCTCA
 
. : . : . : . : . : . :
rJMSF013M05+ CGGAATATAATGGGGTTAGGGTAGCAGGTACTGTTAGCGTAAATTCCATCTCAACATGGC
                      ____________________________________________________________
consensus CGGAATATAATGGGGTTAGGGTAGCAGGTACTGTTAGCGTAAATTCCATCTCAACATGGC
 
. : . : . : . : . : . :
rJMSF013M05+ CTCCATGCATTCTAACTAGCTAGTTCATCTTGTTCTTGCAAGACCATACCACCAGGAATT
                      ____________________________________________________________
consensus CTCCATGCATTCTAACTAGCTAGTTCATCTTGTTCTTGCAAGACCATACCACCAGGAATT