Previous Contig 011750:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013K16Sequence486011750 (2)710011750 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013K16- GGTAATGATTCTTATCTTTAATTTCTTGAAAAATAAAAAATTAGGGTTCT
rJMSF013K16+ GGTAATGATTCTTATCTTTAATTTCTTGAAAAATAAAAAATTAGGGTTCT
                      ____________________________________________________________
consensus GGTAATGATTCTTATCTTTAATTTCTTGAAAAATAAAAAATTAGGGTTCT
 
. : . : . : . : . : . :
JMSF013K16- CAGCTTCCTCTTAGCTGGTAAGAGAATGGGGGGTGGGTGTAGTGGATTACTACTGCGTCG
rJMSF013K16+ CAGCTTCCTCTTAGCTGGTAAGAGAATGGGGGGTGGGTGTAGTGGATTACTACTGCGTCG
                      ____________________________________________________________
consensus CAGCTTCCTCTTAGCTGGTAAGAGAATGGGGGGTGGGTGTAGTGGATTACTACTGCGTCG
 
. : . : . : . : . : . :
JMSF013K16- TCTACTGCTTCTGTATTTGCTGGGTTTTGTGCTCAGCCTCAGCCACGTTTTTTCAGGTGA
rJMSF013K16+ TCTACTGCTTCTGTATTTGCTGGGTTTTGTGCTCAGCCTCAGCCACGTTTTTTCAGGTGA
                      ____________________________________________________________
consensus TCTACTGCTTCTGTATTTGCTGGGTTTTGTGCTCAGCCTCAGCCACGTTTTTTCAGGTGA
 
. : . : . : . : . : . :
JMSF013K16- AGCCGCCGTGGCTAAAGACGACCACCGAATAGCGTGCACAACGTGCTTCCCCTCCCCACC
rJMSF013K16+ AGCCGCCGTGGCTAAAGACGACCACCGAATAGCGTGCACAACGTGCTTCCCCTCCCCACC
                      ____________________________________________________________
consensus AGCCGCCGTGGCTAAAGACGACCACCGAATAGCGTGCACAACGTGCTTCCCCTCCCCACC
 
. : . : . : . : . : . :
JMSF013K16- TCCGCCACCGCTGCCGCCGACCGCCCCAGTCTTGCCCAACAGCCCACCGCCGCCCGTTAA
rJMSF013K16+ TCCGCCACCGCTGCCGCCGACCGCCCCAGTCTTGCCCAACAGCCCACCGCCGCCCGTTAA
                      ____________________________________________________________
consensus TCCGCCACCGCTGCCGCCGACCGCCCCAGTCTTGCCCAACAGCCCACCGCCGCCCGTTAA
 
. : . : . : . : . : . :
JMSF013K16- TCCGTTCGGGCCCCCGCCGCCTCCGCCTGGAGTGATTTATCCACCCCCGTATTACTACAT
rJMSF013K16+ TCCGTTCGGGCCCCCGCCGCCTCCGCCTGGAGTGATTTATCCACCCCCGTATTACTACAT
                      ____________________________________________________________
consensus TCCGTTCGGGCCCCCGCCGCCTCCGCCTGGAGTGATTTATCCACCCCCGTATTACTACAT
 
. : . : . : . : . : . :
JMSF013K16- TCCACCGTCAAAGTCCGTTGTGTTGACAGCAAACAACCACTTATTTTTTCTTTCTTCCTC
rJMSF013K16+ TCCACCGTCAAAGTCCGTTGTGTTGACAGCAAACAACCACTTATTTTTTCTTTCTTCCTC
                      ____________________________________________________________
consensus TCCACCGTCAAAGTCCGTTGTGTTGACAGCAAACAACCACTTATTTTTTCTTTCTTCCTC
 
. : . : . : . : . : . :
JMSF013K16- CTTTATGTTTGCCCTTTCTTTCCTCGTTTTTGCATGATTATATTGCAGACGAGAATGGCG
rJMSF013K16+ CTTTATGTTTGCCCTTTCTTTCCTCGTTTTTGCATGATTATATTGCAGACGAGAATGGCG
                      ____________________________________________________________
consensus CTTTATGTTTGCCCTTTCTTTCCTCGTTTTTGCATGATTATATTGCAGACGAGAATGGCG
 
. : . : . : . : . : . :
JMSF013K16- TACTAATCGAATAGAA
rJMSF013K16+ TACTAATCGAATAGAAGAAGAAGGGTAATGATGCGTGTATATAAAAGTTTCACTGCAGGG
                      ____________________________________________________________
consensus TACTAATCGAATAGAAGAAGAAGGGTAATGATGCGTGTATATAAAAGTTTCACTGCAGGG
 
. : . : . : . : . : . :
rJMSF013K16+ TGAATGCTTCCCTTGCGGTTGTGCGGGTGATTAATGTGTTTGAGTTTTGTACTTAATGTG
                      ____________________________________________________________
consensus TGAATGCTTCCCTTGCGGTTGTGCGGGTGATTAATGTGTTTGAGTTTTGTACTTAATGTG
 
. : . : . : . : . : . :
rJMSF013K16+ CGTGAGTCTTGTGCTTAAGGTGCGTGAGGTTTGTGCTTAATGTACGTGAATGTGTAGTGC
                      ____________________________________________________________
consensus CGTGAGTCTTGTGCTTAAGGTGCGTGAGGTTTGTGCTTAATGTACGTGAATGTGTAGTGC
 
. : . : . : . : . : . :
rJMSF013K16+ TTAAAGTGCGTGAGTTTGTATTTTGAATGTATTTTGTTTGTGTGTTTAATGTGCGTTTGT
                      ____________________________________________________________
consensus TTAAAGTGCGTGAGTTTGTATTTTGAATGTATTTTGTTTGTGTGTTTAATGTGCGTTTGT