Previous Contig 011749:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044B16Sequence633005063 (5)gb:AY062829_15654855e-12Arabidopsis thaliana Unknown protein (At2g19160; T20K24.18) mRNA, complete cds.>638011749 (6)gb:AP004744_18442168e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF009D01Sequence367005063 (5)785011749 (6)gb:AP004751_18443734e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049
JMSF009O08Sequence225005063 (5)771011749 (6)gb:AP004751_18443736e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049
JMSF013J23Sequence389005063 (5)680011749 (6)gb:AP004744_18442162e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF018K12Sequence510005063 (5)gb:AP003992_18360483e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10762011749 (6)gb:AP004751_18443732e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049
JMSF022I19Sequence202019256802011749 (6)gb:AP004751_18443731e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022I19+ AGTTGAA
                      ____________________________________________________________
consensus AGTTGAA
 
. : . : . : . : . : . :
rJMSF018K12+ AAGGGTGCACAGTGGTTTACTATGAAGCGACAGCATGCTGTTATA
rJMSF022I19+ AAGAAAGACTTTCGAAAGGGTGCACAGTGGTTTACTATGAAGCGACAGCATGCTGTTATA
rJMSF009D01+ AAGGGTGCACAGTGGTTTACTATGAAGCGACAGCATGCTGTTATA
                      ____________________________________________________________
consensus AAGAAAGACTTTCGAAAGGGTGCACAGTGGTTTACTATGAAGCGACAGCATGCTGTTATA
 
. : . : . : . : . : . :
rJMSF018K12+ ATTATGGCTGACAATCTTTACTATACTAAATTCCACGATTACTGCAAGCCAAACATGGAT
rJMSF022I19+ ATTATGGCTGACAATCTTTACTATACTAAATTCCACGATTACTGCAAGCCAAACATGGAT
rJMSF009D01+ ATTATGGCTGACAATCTTTACTATACTAAATTCCACGATTACTGCAAGCCAAACATGGAT
rJMSF009O08+ TACTAAATTCCACGATTACTGCAAGCCAAACATGGAT
                      ____________________________________________________________
consensus ATTATGGCTGACAATCTTTACTATACTAAATTCCACGATTACTGCAAGCCAAACATGGAT
 
. : . : . : . : . : . :
rJMSF018K12+ GGAGGGCGTAACTGCTATTCTGATGAGCACTATTTACCAACCTTTTTCTATATGCTTGAT
rJMSF022I19+ GGAGGGCGTAACTGCTATTCTGATGAGCACTATTTACCAACCTTTTTCTATATGCTTGAT
rJMSF009D01+ GGAGGGCGTAACTGCTATTCTGATGAGCGCTATTTACCAACCTTTTTCTATATGCTTGAT
rJMSF009O08+ GGAGGGCGTAACTGCTATTCTGATGAGCACTATTTACCAACCTTTTTCTATATGCTTGAT
                      ____________________________________________________________
consensus GGAGGGCGTAACTGCTATTCTGATGAGCACTATTTACCAACCTTTTTCTATATGCTTGAT
 
. : . : . : . : . : . :
rJMSF018K12+ TCTTCTGGAATTGCAAATTGGTCAGTTACACATGTTGATTGGTCGGAGGGAAAGTGGCAT
rJMSF022I19+ TCTTCTGGAATTGCAAATTGGTCAGTTACACATGTTGATTGGTCGGAGGGAAAGTGGCAT
rJMSF009D01+ TCTTCTGGAATTGCAAATTGGTCAGTTACACATGTTGATTGGTCGGAGGGAAAGTGGCAT
rJMFF044B16+ TTGGTCGGAGGGAAAGTGGCAT
rJMSF009O08+ TCTTCTGGAATTGCAAATTGGTCAGTTACACATGTTGATTGGTCGGAGGGAAAGTGGCAT
rJMSF013J23+ GGTCGGAGGGAAAGTGGCAT
                      ____________________________________________________________
consensus TCTTCTGGAATTGCAAATTGGTCAGTTACACATGTTGATTGGTCGGAGGGAAAGTGGCAT
 
. : . : . : . : . : . :
rJMSF018K12+ -CCCAAATCATACACCAGCCGTGATGTTACTTATGAGCTGATGAAAAACATTACATCAAT
rJMSF022I19+ -CCCAAATCATACACCAGCCGTGATGTTACTTATGAGCTGATGAAAAACATTACATCAAT
rJMSF009D01+ -CCCAAATCATACACCAGCCGTGATGTTACTTATGAGCTGATGAAAAACATTACATCAAT
rJMFF044B16+ -CCCAAATCATACACCAGCCGTGATGTTACTTATGAGCTGATGAAAAACATTACATCAAT
rJMSF009O08+ -CCCAAATCATACACCAGCCGTGATGTTACTTATGAGCTGATGAAAAACATTACATCAAT
rJMSF013J23+ CCCCAAATCATACACCAGCCGTGATGTTACTTATGAGCTGATGAAAAACATTACATCAAT
                      ____________________________________________________________
consensus -CCCAAATCATACACCAGCCGTGATGTTACTTATGAGCTGATGAAAAACATTACATCAAT
 
. : . : . : . : . : . :
rJMSF018K12+ TACTGAGAGCGTGCATGTTACCAGTGATGCCAGGAAGGAAGTTCAAACTAGGCCCTGTTT
rJMSF022I19+ TACTGAGAGCGTGCATGTTACCAGTGATGCCAGGAAGGAAGTTCAAACTAGGCCCTGTTT
rJMSF009D01+ TACTGAGAGCGTGCATGTTACCAGTGATGCCAGGAAGGAAGTTCAAACTAGGCCCTGTTT
rJMFF044B16+ TACTGAGAGCGTGCATGTTACCAGTGATGCCAGGAAGGAAGTTCAAACTAGGCCCTGTTT
rJMSF009O08+ TACTGAGAGCGTGCATGTTACCAGTGATGCCAGGAAGGAAGTTCAAACTAGGCCCTGTTT
rJMSF013J23+ TACTGAGAGCGTGCATGTTACCAGTGATGCCAGGAAGGAAGTTCAAACTAGGCCCTGTTT
                      ____________________________________________________________
consensus TACTGAGAGCGTGCATGTTACCAGTGATGCCAGGAAGGAAGTTCAAACTAGGCCCTGTTT
 
. : . : . : . : . : . :
rJMSF018K12+ ATGGAATGGGAATGAACGACCGTGTTACCTGTTTGGGAGGAAATTCTTACCTGAAACTCT
rJMSF022I19+ ATGGAATGGGAATGAACGACCGTGTTACCTGTTTGGGAGGAAATTCTTACCTGAAACTCT
rJMSF009D01+ ATGGAATGGGAATGAACGACCGTGTTACCTGTTTGGGAGGAAATTCTTACCTGAAACTCT
rJMFF044B16+ ATGGAATGGGAATGAACGACCGTGTTACCTGTTTGGGAGGAAATTCTTACCTGAAACTCT
rJMSF009O08+ ATGGAATGGGAATGAACGACCGTGTTACCTGTTTGGGAGGAAATTCTTACCTGAAACTCT
rJMSF013J23+ ATGGAATGGGAATGAACGACCGTGTTACCTGTTTGGGAGGAAATTCTTACCTGAAACTCT
                      ____________________________________________________________
consensus ATGGAATGGGAATGAACGACCGTGTTACCTGTTTGGGAGGAAATTCTTACCTGAAACTCT
 
. : . : . : . : . : . :
rJMSF018K12+ GGATAACTTGATGCTCCTTTTCCCCAATTACACGTCGATTTGAATGGATTGGTATGTGTA
rJMSF022I19+ GGATAACTTGATGCTCCTTTTCCCCAATTACACGTCGATTTGAATGGATTGGTATGTGTA
rJMSF009D01+ GGATAACTTGATGCTCCTTTTCCCCAATTACACGTCGATTTGAATGGATTGGTATGTGTA
rJMFF044B16+ GGATAACTTGATGCTCCTTTTCCCCAATTACACGTCGATTTGAATGGATTGGTATGTGTA
rJMSF009O08+ GGATAACTTGATGCTCCTTTTCCCCAATTACACGTCGATTTGAATGGATTGGTATGTGTA
rJMSF013J23+ GGATAACTTGATGCTCCTTTTCCCCAATTACACGTCGATTTGAATGGATTGGTATGTGTA
                      ____________________________________________________________
consensus GGATAACTTGATGCTCCTTTTCCCCAATTACACGTCGATTTGAATGGATTGGTATGTGTA
 
. : . : . : . : . : . :
rJMSF018K12+ AGACTAATTCTTTGGTCGATAGAATTCGACTCCCTTCTTCTGCTGCATTTGTGATGTACC
rJMSF022I19+ AGACTAATTCTTTGGTCGATAGAATTCGACTCCCTTCTTCTGCTGCATTTGTGATGTACC
rJMSF009D01+ AGACTAATTCTTTGGTCGATAGAATTCGACTCCCTTCTTCTGCTGCATTTGTGATGTACC
rJMFF044B16+ AGACTAATTCTTTGGTCGATAGAATTCGACTCCCTTCTTCTGCTGCATTTGTGATGTACC
rJMSF009O08+ AGACTAATTCTTTGGTCGATAGAATTCGACTCCCTTCTTCTGCTGCATTTGTGATGTACC
rJMSF013J23+ AGACTAATTCTTTGGTCGATAGAATTCGACTCCCTTCTTCTGCTGCATTTGTGATGTACC
                      ____________________________________________________________
consensus AGACTAATTCTTTGGTCGATAGAATTCGACTCCCTTCTTCTGCTGCATTTGTGATGTACC
 
. : . : . : . : . : . :
rJMSF018K12+ AACCGCTATTGTAAAGTGCCCCACGCACGGTATAGAAGGCTTGATTGCTCACCGAGGCTA
rJMSF022I19+ AACCGCTATTGTAAAGTGCCCCACGCACGGTATAGAAGGCTTGATTGCTCACCGAGGCTA
rJMSF009D01+ AACCGCTATTGTAAAGTGCCCCACGCACGGTATAGAAGGCTTGATTGCTCACCGAGGCTA
rJMFF044B16+ AACCGCTATTGTAAAGTGCCCCACGCACGGTATAGAAGGCTTGATTGCTCACCGAGGCTA
rJMSF009O08+ AACCGCTATTGTAAAGTGCCCCACGCACGGTATAGAAGGCTTGATTGCTCACCGAGGCTA
rJMSF013J23+ AACCGCTATTGTAAAGTGCCCCACGCACGGTATAGAAGGCTTGATTGCTCACCGAGGCTA
                      ____________________________________________________________
consensus AACCGCTATTGTAAAGTGCCCCACGCACGGTATAGAAGGCTTGATTGCTCACCGAGGCTA
 
. : . : . : . : . : . :
rJMSF018K12+ CTTGTTGAGGACAGAGGCGATCCAGTTGCTAGCAGTTAGTCGTCAAGCTTTGCTGGGGTG
rJMSF022I19+ CTTGTTGAGGACAGAGGCGATCCAGTTGCTAGCAGTTAGTCGTCAAGCTTTGCTGGGGTG
rJMSF009D01+ CTTGTTGAGGACAGAGGCGATCCAGTTGCTAGCAGTTAGTCGTCAAGCTTTGCTGGGGTG
rJMFF044B16+ CTTGTTGAGGACAGAGGCGATCCAGTTGCTAGCAGTTAGTCGTCAAGCTTTGCTGGGGTG
rJMSF009O08+ CTTGTTGAGGACAGAGGCGATCCAGTTGCTAGCAGTTAGTCGTCAAGCTTTGCTGGGGTG
rJMSF013J23+ CTTGTTGAGGACAGAGGCGATCCAGTTGCTAGCAGTTAGTCGTCAAGCTTTGCTGGGGTG
                      ____________________________________________________________
consensus CTTGTTGAGGACAGAGGCGATCCAGTTGCTAGCAGTTAGTCGTCAAGCTTTGCTGGGGTG
 
. : . : . : . : . : . :
rJMSF018K12+ TTGGTGTTTTTTGTGTTATTTTTACCCCTAAATTTTGGGCTATTTATGTCATGGTAATCT
rJMSF022I19+ TTGGTGTTTTTTGTGTTATTTTTACCCCTAAATTTTGGGCTATTTATGTCATGGTAATCT
rJMSF009D01+ TTGGTGTTTTTTGTGTTATTTTTACCCCTAAATTTTGGGCTATTTATGTCATGGTAATCT
rJMFF044B16+ TTGGTGTTTTTTGTGTTATTTTTACCCCTAAATTTTGGGCTATTTATGTCATGGTAATCT
rJMSF009O08+ TTGGTGTTTTTTGTGTTATTTTTACCCCTAAATTTTGGGCTATTTATGTCATGGTAATCT
rJMSF013J23+ TTGGTGTTTTTTGTGTTATTTTTACCCCTAAATTTTGGGCTATTTATGTCATGGTAATCT
                      ____________________________________________________________
consensus TTGGTGTTTTTTGTGTTATTTTTACCCCTAAATTTTGGGCTATTTATGTCATGGTAATCT
 
. : . : . : . : . : . :
rJMSF018K12+ TTGGACACGAAAATATTTGAGGACATTCAACTGTGCATCATCACTGTACGTTTGACCA
rJMSF022I19+ TTGGACACGAAAATATTTGAGGACATTCAACTGTGCATCATCACTGTACGTTTGACCATT
rJMSF009D01+ TTGGACACGAAAATATTTGAGGACATTCAACTGTGCATCATCACTGTACGTTTGACCATT
rJMFF044B16+ TTGGACACGAAAATATTTGAGGACATTCAACTGTGCATCATCACTGTACGTTTGACCATT
rJMSF009O08+ TTGGACACGAAAATATTTGAGGACATTCAACTGTGCATCATCACTGTACGTTTGACCATT
rJMSF013J23+ TTGGACACGAAAATATTTGAGGACATTCAACTGTGCATCATCACTGTACGTTTGACCATT
                      ____________________________________________________________
consensus TTGGACACGAAAATATTTGAGGACATTCAACTGTGCATCATCACTGTACGTTTGACCATT
 
. : . : . : . : . : . :
rJMSF022I19+ GTAGGAGATGCAAATT
rJMSF009D01+ GTAGGAGATGCAAATT
rJMFF044B16+ GTAGGAGATGCAAATTTGTGAAAGTTGTGAATATAGCCCGGCAA
rJMSF009O08+ GTAGGAGATGCAAATTTGTGAAAGTTGTGAATATAGCCCGGCAA
rJMSF013J23+ GTAGGAGATGCAAATTTGTGAAAGTTGTGAATATAGCCCGGCAACAACTCACTCACTGCT
                      ____________________________________________________________
consensus GTAGGAGATGCAAATTTGTGAAAGTTGTGAATATAGCCCGGCAACAACTCACTCACTGCT
 
. : . : . : . : . : . :
rJMSF013J23+ GTCTTTTACTGCTTTGTAGAACCAACCAGATATATATAATTTTCTGAAAACTGGAAATTC
                      ____________________________________________________________
consensus GTCTTTTACTGCTTTGTAGAACCAACCAGATATATATAATTTTCTGAAAACTGGAAATTC