Previous Contig 011740:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038E05Sequence558011740 (10)pir|S72515|S725157e-88GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra741011740 (10)pir|S72515|S72515e-101GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra
JMFN035B08Sequence618011740 (10)gb:LJRAB1A_16850217e-95L.japonicus mRNA for small GTP-binding protein, RAB1A.
JMSF003M19Sequence515011740 (10)gb:LJRAB1A_16850212e-53L.japonicus mRNA for small GTP-binding protein, RAB1A.
JMSF013G12Sequence506011740 (10)pir|S72515|S725152e-76GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra720011740 (10)pir|S72515|S72515e-103GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra
JMSF023E10Sequence677011740 (10)pir|S72515|S725153e-98GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra753011740 (10)pir|S72515|S72515e-103GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra
JMSF029H08Sequence677011740 (10)pir|S72515|S72515e-102GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra737011740 (10)pir|S72515|S725159e-98GTP-binding protein RAB1 - garden petunia>gb:PHU35026_1700205 Petunia hybrida Ra

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038E05- ATTCTT
JMFN035B08- GCAAACTGACAAGCAAGCTTCTCATATTCTT
rJMSF029H08+ TCTT
rJMSF013G12+ TT
                      ____________________________________________________________
consensus GCAAACTGACAAGCAAGCTTCTCATATTCTT
 
. : . : . : . : . : . :
JMSF013G12- ATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
JMFF038E05- TGCCGACAACTAAAAATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
JMFN035B08- TGCCGACAACTAAAAATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
rJMSF029H08+ TGCCGACAACTAAAAATGAGTACCGAATACGATTATTTGTTTCAAGTTGTTGCTAATCGG
rJMSF023E10+ ACAACTAAAAATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
JMSF029H08- ATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
rJMFF038E05+ TACGATTATTTG-TTCAAGTTGTTGCTAATCGG
JMSF023E10- ATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
rJMSF013G12+ TGCCGACAACTAAAAATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
                      ____________________________________________________________
consensus TGCCGACAACTAAAAATGAGTACCGAATACGATTATTTG-TTCAAGTTGTTGCTAATCGG
 
. : . : . : . : . : . :
JMSF013G12- AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
JMFF038E05- AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
JMFN035B08- AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
rJMSF029H08+ AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
rJMSF023E10+ AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
JMSF029H08- AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
rJMFF038E05+ AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
JMSF023E10- AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
rJMSF013G12+ AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
                      ____________________________________________________________
consensus AGACTCTTCCGTCGGCAAGTCCTGCCTGCTTCTCAGATTCGCTGATGATTCGTACATTGA
 
. : . : . : . : . : . :
JMSF013G12- CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
JMFF038E05- CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
JMFN035B08- CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
rJMSF029H08+ CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
rJMSF023E10+ CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
JMSF029H08- CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
rJMFF038E05+ CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
JMSF023E10- CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
rJMSF013G12+ CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
                      ____________________________________________________________
consensus CAGCTACATTAGCACCATAGGAGTTGACTTCAAAATTAGGACAGTGGAGCTGGATGGGAA
 
. : . : . : . : . : . :
JMSF013G12- GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
JMFF038E05- GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
JMFN035B08- GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
rJMSF029H08+ GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
rJMSF023E10+ GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
JMSF029H08- GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
rJMFF038E05+ GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
JMSF023E10- GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
rJMSF003M19+ G
rJMSF013G12+ GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
                      ____________________________________________________________
consensus GACTATCAAGCTGCAAATTTGGGATACTGCTGGCCAGGAGCGTTTCCGGACTATTACAAG
 
. : . : . : . : . : . :
JMSF013G12- CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
JMFF038E05- CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
JMFN035B08- CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
rJMSF029H08+ CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
rJMSF023E10+ CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
JMSF029H08- CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
rJMFF038E05+ CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
JMSF023E10- CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
rJMSF003M19+ CAGTTNCTATCGTGGTGCACATGGAATCATTATTGTNTATGATGTNACCGAAATGGAGAG
rJMSF013G12+ CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
                      ____________________________________________________________
consensus CAGTTACTATCGTGGTGCACATGGAATCATTATTGTCTATGATGTTACCGAAATGGAGAG
 
. : . : . : . : . : . :
JMSF013G12- CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
JMFF038E05- CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
JMFN035B08- CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
rJMSF029H08+ CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
rJMSF023E10+ CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
JMSF029H08- CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
rJMFF038E05+ CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
JMSF023E10- CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
rJMSF003M19+ CTTCAACAATGTCANGCAATGNCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTNG
rJMSF013G12+ CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
                      ____________________________________________________________
consensus CTTCAACAATGTCAAGCAATGGCTGAGTGAAATCGACAGATATGCAAATGATAGCGTTTG
 
. : . : . : . : . : . :
JMSF013G12- CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
JMFF038E05- CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
JMFN035B08- CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
rJMSF029H08+ CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
rJMSF023E10+ CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
JMSF029H08- CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
rJMFF038E05+ CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
JMSF023E10- CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
rJMSF003M19+ CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
rJMSF013G12+ CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
                      ____________________________________________________________
consensus CAAGCTTTTAGTTGGAAACAAGTGTGATTTGGCAGAGAACAAGGTTGTGGACACAGAAAC
 
. : . : . : . : . : . :
JMSF013G12- GGCAAAGGCATTTGCNAATGAGCTCGGTATACCTTTCCTG
JMFF038E05- GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
JMFN035B08- GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
rJMSF029H08+ GGCAAAGGCATTTGCAAATGAGCTCAGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
rJMSF023E10+ GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
JMSF029H08- GGCAAAGGCATTTGCAAATGAGCTCAGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
rJMFF038E05+ GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
JMSF023E10- GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
rJMSF003M19+ GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGATTAGTGCAAAAGATTC
rJMSF013G12+ GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
                      ____________________________________________________________
consensus GGCAAAGGCATTTGCAAATGAGCTCGGTATACCTTTCCTGGAGACTAGTGCAAAAGATTC
 
. : . : . : . : . : . :
JMFF038E05- CATCAACCGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
JMFN035B08- CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAANAAAATGGGCA
rJMSF029H08+ CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
rJMSF023E10+ CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
JMSF029H08- CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
rJMFF038E05+ CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
JMSF023E10- CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
rJMSF003M19+ CATCAA-CGTGGAGCAGGCTTTNTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
rJMSF013G12+ CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
                      ____________________________________________________________
consensus CATCAA-CGTGGAGCAGGCTTTCTTAACCATGGCTGGTGAAATTAAGAAAAAAATGGGCA
 
. : . : . : . : . : . :
JMFF038E05- CACAACCTGCTGG
JMFN035B08- CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAA
rJMSF029H08+ CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCAATCCAAC
rJMSF023E10+ CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCAATCCAAC
JMSF029H08- CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCNATCCAAC
rJMFF038E05+ CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCAATCCAAC
JMSF023E10- CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCNATCC
rJMSF003M19+ CACAACCTGCTGGAANCNAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCAATCCAAC
rJMSF013G12+ CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCAATCCAAC
                      ____________________________________________________________
consensus CACAACCTGCTGGAAACAAGTCAGCTAGTACTGTTCAAATCAAGGGACAGCCAATCCAAC
 
. : . : . : . : . : . :
rJMSF029H08+ AGAAGAGCAATTGTTGTAGCTAACTACTTATAGTGTAGTTGTATCCTGCTTTACAAATGT
rJMSF023E10+ AGAAGAGCAATTGTTGTAGCTAAC
JMSF029H08- AGAAGAGCAATTGTTGTAGCTAACTACTTATA
rJMFF038E05+ AGAAGAGCAATTGTTGTAGCTAAC
rJMSF003M19+ AGAAGAGCAATTGTTGTAGCTAAC
rJMSF013G12+ AGAAGAGCAATTGTTGTAGCTAACTACTTATAGTGTAGTTGTATCCTGCTTTACAAATGT
                      ____________________________________________________________
consensus AGAAGAGCAATTGTTGTAGCTAACTACTTATAGTGTAGTTGTATCCTGCTTTACAAATGT
 
. : . : . : . : . : . :
rJMSF029H08+ TGAATGCAAAGTAATCAAATATGTATTTCCCAGATTATGTTTA-CATGTGA
rJMSF013G12+ TGAATGCAAAGTAATCAAATATGTATTTCCCAGATTATGTTTACCATGTGACAACATGTT
                      ____________________________________________________________
consensus TGAATGCAAAGTAATCAAATATGTATTTCCCAGATTATGTTTACCATGTGACAACATGTT