Previous Contig 011739:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012A12Sequence496014282sp|Q9M7I7|CLH2_ARATH2e-13Chlorophyllase 2, chloroplast precursor (EC 3.1.1.14) (AtCLH2) (Chlorophyll-chlo585011739 (3)gb:AY292526_15956378e-29Ginkgo biloba chlorophyllase (CLH) mRNA, complete cds.
JMSF013G11Sequence440001738 (33)gb:ATAC009400_15429712e-15Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen739011739 (3)gb:AY292526_15956373e-46Ginkgo biloba chlorophyllase (CLH) mRNA, complete cds.
JMSF022N02Sequence712011739 (3)gb:AY292526_15956373e-46Ginkgo biloba chlorophyllase (CLH) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022N02+ ACTAGCGTTATCCGGACACAGCCGGG
rJMSF013G11+ TTATCCGGACACAGCCGGG
                      ____________________________________________________________
consensus ACTAGCGTTATCCGGACACAGCCGGG
 
. : . : . : . : . : . :
rJMSF022N02+ GAGGGAAAGTAGCATTCGCGCTAGCTCTGGGCAAGACGGCGACGGCTGATCTGAAATTCT
rJMSF013G11+ GAGGGAAAGTAGCATTCGCGCTAGCTCTGGGCAAGACGGCGACGGCTGATCTGAAATTCT
                      ____________________________________________________________
consensus GAGGGAAAGTAGCATTCGCGCTAGCTCTGGGCAAGACGGCGACGGCTGATCTGAAATTCT
 
. : . : . : . : . : . :
rJMSF022N02+ CAGCCATAATCGGCGTGGACCCCGTCGGCGGAACATGCCCTGATGTCCTCAACTCCACTC
rJMSF013G11+ CAGCCATAATCGGCGTGGACCCCGTCGGCGGAACATGCCCTGATGTCCTCAACTCCACTC
                      ____________________________________________________________
consensus CAGCCATAATCGGCGTGGACCCCGTCGGCGGAACATGCCCTGATGTCCTCAACTCCACTC
 
. : . : . : . : . : . :
rJMSF022N02+ CTGATTACTTCGACCTTAACATGCCAGCAATGGTGATCGGGTCGGGCTTGGGAGATGTCA
rJMFF012A12+ TTAACATGCCAGCAATGGTGATCGGGTCGGGCTTGGGAGATGTCA
rJMSF013G11+ CTGATTACTTCGACCTTAACATGCCAGCAATGGTGATCGGGTCGGGCTTGGGAGATGTCA
                      ____________________________________________________________
consensus CTGATTACTTCGACCTTAACATGCCAGCAATGGTGATCGGGTCGGGCTTGGGAGATGTCA
 
. : . : . : . : . : . :
rJMSF022N02+ AGAAGAATCTTTTGAGCTGCCCTTGCGCGCCCAAGGGGTCGAACTATGCCGCTTTCTACA
rJMFF012A12+ AGAAGAATCTTTTGAGCTGCCCTTGCGCGCCCAAGGGGTCGAACTATGCCGCTTTNTACA
rJMSF013G11+ AGAAGAATCTTTTGAGCTGCCCTTGCGCGCCCAAGGGGTCGAACTATGCCGCTTTCTACA
                      ____________________________________________________________
consensus AGAAGAATCTTTTGAGCTGCCCTTGCGCGCCCAAGGGGTCGAACTATGCCGCTTTCTACA
 
. : . : . : . : . : . :
rJMSF022N02+ GCAAGTGTCGCGCGCCGGCTTGTTGCTTGGTGGCTAAAGACTACGGACACACTGACATGC
rJMFF012A12+ GCAAGTGTCGCGCGCCGGCTTGTTGCTTGGTGGCTAAAGANTACGGACACACTGACATGC
rJMSF013G11+ GCAAGTGTCGCGCGCCGGCTTGTTGCTTGGTGGCTAAAGACTACGGACACACTGACATGC
                      ____________________________________________________________
consensus GCAAGTGTCGCGCGCCGGCTTGTTGCTTGGTGGCTAAAGACTACGGACACACTGACATGC
 
. : . : . : . : . : . :
rJMSF022N02+ TGGACGATGATACGAGAGGGAGTTTGCGTGGGATGCTGACTTATTGTATGTGCAAGAACG
rJMFF012A12+ TGGACGATGATACGAGAGGGAGTTTGCGTGGGATGCTGACTTATTGTATGTGCAAGAACG
rJMSF013G11+ TGGACGATGATACGAGAGGGAGTTTGCGTGGGATGCTGACTTATTGTATGTGCAAGAACG
                      ____________________________________________________________
consensus TGGACGATGATACGAGAGGGAGTTTGCGTGGGATGCTGACTTATTGTATGTGCAAGAACG
 
. : . : . : . : . : . :
rJMSF022N02+ GGCCGGCTAGGGCGCCGATGCGGGCGTTTGTGGGCGGCGCTGTGGTGGCGTTCTTGAGAG
rJMFF012A12+ GGCCGGCTAGGGCGCCGATGCGGGCGTTTGTGGGCGGCGCTGTGGTGGCGTTCTTGAGAG
rJMSF013G11+ GGCCGGCTAGGGCGCCGATGCGGGCGTTTGTGGGCGGCGCTGTGGTGGCGTTCTTGAGAG
                      ____________________________________________________________
consensus GGCCGGCTAGGGCGCCGATGCGGGCGTTTGTGGGCGGCGCTGTGGTGGCGTTCTTGAGAG
 
. : . : . : . : . : . :
rJMSF022N02+ GGTTTTTGGAGAGTGACATGAATCCTTTGATGGGTATTATAGACCAGACTGAAACTGCAC
rJMFF012A12+ GGTTTTTGGAGAGTGACATGAATCCTTTGATGGGTATTATAGACCAGACTGAAACTGCAC
rJMSF013G11+ GGTTTTTGGAGAGTGACATGAATCCTTTGATGGGTATTATAGACCAGACTGAAACTGCAC
                      ____________________________________________________________
consensus GGTTTTTGGAGAGTGACATGAATCCTTTGATGGGTATTATAGACCAGACTGAAACTGCAC
 
. : . : . : . : . : . :
rJMSF022N02+ CTGTTGAGCTTCAACCAGTGGATTCCAAAGATTTGGTGAGGGCCTAAGTTGCATGTTATT
rJMFF012A12+ CTGTTGAGCTTCAACCAGTGGATTCCAAAGATTTGGTGAGGGCCTAAGTTGCATGTTATT
rJMSF013G11+ CTGTTGAGCTTCAACCAGTGGATTCCAAAGATTTGGTGAGGGCCTAAGTTGCATGTTATT
                      ____________________________________________________________
consensus CTGTTGAGCTTCAACCAGTGGATTCCAAAGATTTGGTGAGGGCCTAAGTTGCATGTTATT
 
. : . : . : . : . : . :
rJMSF022N02+ GCAAATGAATGGAATTGAAGGTTGTGTGTCAACTGTCAAGAAAGTATGGTAGGTACTAGG
rJMFF012A12+ GCAAATGAATGGAATTGAAGGTTGTGTGTCAACTGTCAAGAAAGTATGGTAGGTANTAGG
rJMSF013G11+ GCAAATGAATGGAATTGAAGGTTGTGTGTCAACTGTCAAGAAAGTATGGTAGGTACTAGG
                      ____________________________________________________________
consensus GCAAATGAATGGAATTGAAGGTTGTGTGTCAACTGTCAAGAAAGTATGGTAGGTACTAGG
 
. : . : . : . : . : . :
rJMSF022N02+ TAGTAGTAAATGTAGTCAGTATTTGGGAGAAGGGAGTCGAAATGGGATCGTTATATCGTG
rJMFF012A12+ TAGTAGTAAATGTAGTCAGTATTTGGGAGAAGGGAGTCGAAATGGGATCGTTATATCGTG
rJMSF013G11+ TAGTAGTAAATGTAGTCAGTATTTGGGAGAAGGGAGTCGAAATGGGATCGTTATATCGTG
                      ____________________________________________________________
consensus TAGTAGTAAATGTAGTCAGTATTTGGGAGAAGGGAGTCGAAATGGGATCGTTATATCGTG
 
. : . : . : . : . : . :
rJMSF022N02+ TNCCCTGTCCAAAACGATGTCATTTT
rJMFF012A12+ TGCCCTGTCCAAAACGATGTCATTTTTANGTTGA-GTTTAGATGTATTATGTTAAGAGT
rJMSF013G11+ TGCCCTGTCCAAAACGATGTCATTTTTAGGTTGACGTTTAGATGTATTATGTTAAGAGTT
                      ____________________________________________________________
consensus TGCCCTGTCCAAAACGATGTCATTTTTAGGTTGACGTTTAGATGTATTATGTTAAGAGTT