Previous Contig 011737:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013G04Sequence245018826744011737 (4)gb:AP002908_18238193e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001
JMSF017I12Sequence512003921 (5)pir|T48550|T485504e-48probable esterase-like protein - Arabidopsis thaliana>gb:ATF14F18_1548537 Arabid827011737 (4)gb:AP002908_18238194e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001
JMSF018D24Sequence219003921 (5)pir|T48550|T485502e-06probable esterase-like protein - Arabidopsis thaliana>gb:ATF14F18_1548537 Arabid765011737 (4)gb:AP002908_18238193e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001
JMSF045G02Sequence737003921 (5)gb:AY088568_15735851e-70Arabidopsis thaliana clone 7912 mRNA, complete sequence.828011737 (4)gb:AP002908_18238194e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018D24+ CNAGCCCGTTTGACGAAGAGCAGCAAGCTGTTCAAA
                      ____________________________________________________________
consensus CNAGCCCGTTTGACGAAGAGCAGCAAGCTGTTCAAA
 
. : . : . : . : . : . :
rJMSF018D24+ CGGTGGCCCAGGAAATTCTTCACCAAATTCTTCCAAAAGGTCGTGTGAATTGAGTCCAAG
                      ____________________________________________________________
consensus CGGTGGCCCAGGAAATTCTTCACCAAATTCTTCCAAAAGGTCGTGTGAATTGAGTCCAAG
 
. : . : . : . : . : . :
rJMSF018D24+ TAAGAGTCGGTTGTTGTTGTTGTAGCCATCGGAGCCAATGTAGAGCTGCCCCCTCCATAC
                      ____________________________________________________________
consensus TAAGAGTCGGTTGTTGTTGTTGTAGCCATCGGAGCCAATGTAGAGCTGCCCCCTCCATAC
 
. : . : . : . : . : . :
rJMSF018D24+ TAACGAATGCTGTTGGGACCTTCAAATCCTCTCGGGTGTGATGAATGGCAAAGTACTACT
rJMSF045G02+ TGTGATGAATGGCAAAGTACTACT
rJMSF017I12+ TGTGATGAATGGCNAAGTACTACT
                      ____________________________________________________________
consensus TAACGAATGCTGTTGGGACCTTCAAATCCTCTCGGGTGTGATGAATGGCAAAGTACTACT
 
. : . : . : . : . : . :
rJMSF018D24+ CCACTCTAGCCAGCCACCCAATCAGATCTGTGCCTTCAAATGTAGGAAGTTCTGTTTTTC
rJMSF045G02+ CCACTCTAGCCAGCCACCCCATCAGATCTGTGCCTTCAAATGTAGGAAGTTCTGTTTTTC
rJMSF017I12+ CCACTCTAGCCAGCCACCCAATCAGATCTGTGCCTTC-AATGTAGGAAGTTCTGTTTTTC
                      ____________________________________________________________
consensus CCACTCTAGCCAGCCACCCAATCAGATCTGTGCCTTCAAATGTAGGAAGTTCTGTTTTTC
 
. : . : . : . : . : . :
rJMSF018D24+ CAATGGGCAACGAGGTGTTGTCCGGCTGAACATGTTCTGGAAGAGAGGTTGAATTCGGCA
rJMSF045G02+ CAATGGGCAACGAGGTGTTGTCCGGCTGAACATGTTCTGGAAGAGAGGTTGAATTCGGCA
rJMSF017I12+ CAATGGGCAACGAGGTGTTGTCCGGCTGAACATGTTCTGGAAGAGAGGTTGAATTCGGCA
                      ____________________________________________________________
consensus CAATGGGCAACGAGGTGTTGTCCGGCTGAACATGTTCTGGAAGAGAGGTTGAATTCGGCA
 
. : . : . : . : . : . :
rJMSF018D24+ TTGGATGGAAGTTGATGAAGCACTGGCATTGTTGTGCCCTCCGCCTTGGAAGGAGAGAGC
rJMSF045G02+ TTGGATGGAAGTTGATGAAGCACTGGCATTGTTGTGCCCTCCGCCTTGGAAGGAGAGAGC
rJMSF017I12+ TTGGATGGAAGTTGATGAAGCACTGGCATTGTTGTGCCCTCCGCCTTGGAAGGAGAGAGC
rJMSF013G04+ CCCTCCGCCTTGGAAGGAGAGAGC
                      ____________________________________________________________
consensus TTGGATGGAAGTTGATGAAGCACTGGCATTGTTGTGCCCTCCGCCTTGGAAGGAGAGAGC
 
. : . : . : . : . : . :
rJMSF018D24+ GAGGAGATCAGACATCCTAGCCATGGAAGCTTCCATGGCTGCAAATCGATCATTCAATGT
rJMSF045G02+ GAGGAGATCAGACATCCTAGCCATGGAAGCTTCCATGGCTGCAAATCGATCATTCAATGT
rJMSF017I12+ GAGGAGATCAGACATCCTAGCCATGGAAGCTTCCATGGCTGCAAATCGATCATTCAATGT
rJMSF013G04+ GAGGAGATCAGACATCCTAGCCATGGAAGCTTCCATGGCTGCAAATCGATCATTCAATGT
                      ____________________________________________________________
consensus GAGGAGATCAGACATCCTAGCCATGGAAGCTTCCATGGCTGCAAATCGATCATTCAATGT
 
. : . : . : . : . : . :
rJMSF018D24+ GGCCAATTCAGCACGGATTGCATCTTGGTTCTTCTCTAACGTCTCTACTTGGGAATCTCG
rJMSF045G02+ GGCCAATTCAGCACGGATTGCATCTTGGTTCTTCTCTAACGTCTCTACTTGGGAATCTCG
rJMSF017I12+ GGCCAATTCAGCACGGATTGCATCTTGGTTCTTCTCTAACGTCTCTACTTGGGAATCTCG
rJMSF013G04+ GGCCAATTCAGCACGGATTGCATCTTGGTTCTTCTCTAACGTCTCTACTTGGGAATCTCG
                      ____________________________________________________________
consensus GGCCAATTCAGCACGGATTGCATCTTGGTTCTTCTCTAACGTCTCTACTTGGGAATCTCG
 
. : . : . : . : . : . :
rJMSF018D24+ TTTGTTCGTCATTCAACGGCAGGTCGGACCAATTTGTTAGAGAAAAGAACAAGGAGGGTG
rJMSF045G02+ TTTGTTCGTCATTCAACGGCAGGTCGGACCAATTTGTTAGAGAAAAGAACAAGGAGGGTG
rJMSF017I12+ TTTGTTCGTCATTCAACGGCAGGTCGGACCAATTTGTTAGAGAAAAGAACAAGGAGGGTG
rJMSF013G04+ TTTGTTCGTCATTCAACGGCAGGTCGGACCAATTTGTTAGAGAAAAGAACAAGGAGGGTG
                      ____________________________________________________________
consensus TTTGTTCGTCATTCAACGGCAGGTCGGACCAATTTGTTAGAGAAAAGAACAAGGAGGGTG
 
. : . : . : . : . : . :
rJMSF018D24+ TTGACGATCCATGGTTCAAGGGATGAAATGGTGCCTGTTGATGATGCCCTGGAATTCGCC
rJMSF045G02+ TTGACGATCCATGGTTCAAGGGATGAAATGGTGCCTGTTGATGATGCCCTGGAATTCGCC
rJMSF017I12+ TTGACGATCCATGGTTCAAGGGATGAAATGGTGCCTGTTGATGATGCCCTGGAATTCGCC
rJMSF013G04+ TTGACGATCCATGGTTCAAGGGATGAAATGGTGCCTGTTGATGATGCCCTGGAATTCGCC
                      ____________________________________________________________
consensus TTGACGATCCATGGTTCAAGGGATGAAATGGTGCCTGTTGATGATGCCCTGGAATTCGCC
 
. : . : . : . : . : . :
rJMSF018D24+ AAGTACATCCCAACCCACACACTGCACATTATCGAGGGAGCAGATCATGAATTTACCTTG
rJMSF045G02+ AAGTACATCCCAACCCACACACTGCACATTATCGAGGGAGCAGATCATGAATTTACCTTG
rJMSF017I12+ AAGTACATCCCAACCCACACACTGCACATTATCGAGGGAGCAGATCATGAATTTACCTTG
rJMSF013G04+ AAGTACATCCCAACCCACACACTGCACATTATCGAGGGAGCAGATCATGAATTTACCTTG
                      ____________________________________________________________
consensus AAGTACATCCCAACCCACACACTGCACATTATCGAGGGAGCAGATCATGAATTTACCTTG
 
. : . : . : . : . : . :
rJMSF018D24+ CACCAAGATGAATTGGCTTCTCTAGTTGTCGCCTTTGTCATGGCTAGTGTATCTAACGAA
rJMSF045G02+ CACCAAGATGAATTGGCTTCTCTAGTTGTCGCCTTTGTCATGGCTAGTGTATCTAACGAA
rJMSF017I12+ CACCAAGATGAATTGGCTTCTCTAGTTGTCGCCTTTGTCATGGCTAGTGTATCTAACGAA
rJMSF013G04+ CACCAAGATGAATTGGCTTCTCTAGTTGTCGCCTTTGTCATGGCTAGTGTATCTAACGAA
                      ____________________________________________________________
consensus CACCAAGATGAATTGGCTTCTCTAGTTGTCGCCTTTGTCATGGCTAGTGTATCTAACGAA
 
. : . : . : . : . : . :
rJMSF018D24+ GAAATAACC
rJMSF045G02+ GAAATAACCAAACCATCGGAGTCATGCGTAAGAAAACACAAATCAATTCATTCTCGATTC
rJMSF017I12+ GAAATAACCAAACCATCGGAGTCATGCGTAAGAAAACACAAATCAATTCATTCTCGATTC
rJMSF013G04+ GAAATAACCAAACCATCGGAGTCATGCGTAAGAAAACACAAATCAATTCATTCTCGATTC
                      ____________________________________________________________
consensus GAAATAACCAAACCATCGGAGTCATGCGTAAGAAAACACAAATCAATTCATTCTCGATTC
 
. : . : . : . : . : . :
rJMSF045G02+ TGATTTCGTCTACTTTTGAGCTATGTGCTTTGCCCTTTTCAGCAACATTATATTATGAAG
rJMSF017I12+ TGATTTCGTCTACTTTTGAGCTATGTGCTTTGCCCTTTTCAGCAACATTATATTATGAAG
rJMSF013G04+ TGATTTCGTCTACTTTTGAGCTATGTGCTTTGCCCTTTTCAGCAACATTATATTATGAAG
                      ____________________________________________________________
consensus TGATTTCGTCTACTTTTGAGCTATGTGCTTTGCCCTTTTCAGCAACATTATATTATGAAG
 
. : . : . : . : . : . :
rJMSF045G02+ CAAATACTTGAGAAATATTCTTGAGAATGAAACTAGGCCTCAATAAATGGCCAAGATATT
rJMSF017I12+ CAAATACTTGAGAAATATTCTTGAGAATGAAACTAGGCCTCAATAAATGGCCAAGATATT
rJMSF013G04+ CAAATACTTGAGAAATATTCTTGAGAATGAAACTAGGCCTCAATAAATGGCCAAGATATT
                      ____________________________________________________________
consensus CAAATACTTGAGAAATATTCTTGAGAATGAAACTAGGCCTCAATAAATGGCCAAGATATT
 
. : . : . : . : . : . :
rJMSF045G02+ GCTGAAATGTATATTAAATAGTACTAGAAAAGAAGCATGTGGAACTGCCACGGTAAAGAA
rJMSF017I12+ GCTGAAATGTATATTAAATAGTACTAGAAAAGAAGCATGTGGAACTGCCACGGTAAAGAA
rJMSF013G04+ GCTGAAATGTATATTAAATAGTACTAGAAAAGAAGCATGTGGAACTGCCACGGTAAAGAA
                      ____________________________________________________________
consensus GCTGAAATGTATATTAAATAGTACTAGAAAAGAAGCATGTGGAACTGCCACGGTAAAGAA
 
. : . : . : . : . : . :
rJMSF045G02+ TGTTCTTCCTATTGTGTTTCGT
rJMSF017I12+ TGTTCTTCCTATTGTGTTTCGT
rJMSF013G04+ TGTTCTTCCTATTGTGTTTCGTGTTGGGTTTGGACAAAGAATGAATGTAGGCATTCTTTT
                      ____________________________________________________________
consensus TGTTCTTCCTATTGTGTTTCGTGTTGGGTTTGGACAAAGAATGAATGTAGGCATTCTTTT
 
. : . : . : . : . : . :
rJMSF013G04+ GTTATACATGAATTCTAGGTGTATGGCAAACTAAGCTACGATGTAAACAGCTAGGAGTTC
                      ____________________________________________________________
consensus GTTATACATGAATTCTAGGTGTATGGCAAACTAAGCTACGATGTAAACAGCTAGGAGTTC