Previous Contig 011736:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013G01Sequence252005399 (4)700011736 (3)
JMSF039N15Sequence649005399 (4)841011736 (3)
JMSF047O14Sequence695005399 (4)716011736 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039N15+ TAATATTGAGCAGCATCAATAGCAGGAGCAGCAGTACCAGCTTT
                      ____________________________________________________________
consensus TAATATTGAGCAGCATCAATAGCAGGAGCAGCAGTACCAGCTTT
 
. : . : . : . : . : . :
rJMSF039N15+ CCTGAAGAGGCCTCAGCAGCAAGAACTGAGTTGTTTGAAGAAGACAAAACCATATAAAAG
                      ____________________________________________________________
consensus CCTGAAGAGGCCTCAGCAGCAAGAACTGAGTTGTTTGAAGAAGACAAAACCATATAAAAG
 
. : . : . : . : . : . :
rJMSF039N15+ AATGGGGAAAAAAATTGAATCCTTTTAGGCAAATACAATTTACATATATAATACAGTATT
rJMSF047O14+ CTTTTAGGCAAATACAATTTACATATATAATACAGTATT
rJMSF013G01+ CTTTTAGGCAAATACAATTTACATATATAATACAGTATT
                      ____________________________________________________________
consensus AATGGGGAAAAAAATTGAATCCTTTTAGGCAAATACAATTTACATATATAATACAGTATT
 
. : . : . : . : . : . :
rJMSF039N15+ GCTTTTATTAAGGAGTCCCAATACTAAACACATTCACAAATATTCTGAATATTTCAATTT
rJMSF047O14+ GCTTTTATTAAGGAGTCCCAATACTAAACACATTCACAAATATTCTGAATATTTCAATTT
rJMSF013G01+ GCTTTTATTAAGGAGTCCCAATACTAAACACATTCACAAATATTCTGAATATTTCAATTT
                      ____________________________________________________________
consensus GCTTTTATTAAGGAGTCCCAATACTAAACACATTCACAAATATTCTGAATATTTCAATTT
 
. : . : . : . : . : . :
rJMSF039N15+ TAAAAATCATTTGAAATTTTGAATAATTTTATCTAAAATATTAAATTTGGAAAATGAAGG
rJMSF047O14+ TAAAAATCATTTGAAATTTTGAATAATTTTATCTAAAATATTAAATTTGGAAAATGAAGG
rJMSF013G01+ TAAAAATCATTTGAAATTTTGAATAATTTTATCTAAAATATTAAATTTGGAAAATGAAGG
                      ____________________________________________________________
consensus TAAAAATCATTTGAAATTTTGAATAATTTTATCTAAAATATTAAATTTGGAAAATGAAGG
 
. : . : . : . : . : . :
rJMSF039N15+ TAAAAAATGTTCTTGTTGCCCAAAACACTTCACACCCCCATTTAGCTCTCTAACTGTTGT
rJMSF047O14+ TAAAAAATGTTCTTGTTGCCCAAAACACTTCACACCCCCATTTAGCTCTCTAACTGTTGT
rJMSF013G01+ TAAAAAATGTTCTTGTTGCCCAAAACACTTCACACCCCCATTTAGCTCTCTAACTGTTGT
                      ____________________________________________________________
consensus TAAAAAATGTTCTTGTTGCCCAAAACACTTCACACCCCCATTTAGCTCTCTAACTGTTGT
 
. : . : . : . : . : . :
rJMSF039N15+ AAAGGCTTTATTGGGTTGTGTGGCCCATGCTAACTTGGCCAAACAGGTAAAAAGATGGTG
rJMSF047O14+ AAAGGCTTTATTGGGTTGTGTGGCCCATGCTAACTTGGCCAAACAGGTAAAAAGATGGTG
rJMSF013G01+ AAAGGCTTTATTGGGTTGTGTGGCCCATGCTAACTTGGCCAAACAGGTAAAAAGATGGTG
                      ____________________________________________________________
consensus AAAGGCTTTATTGGGTTGTGTGGCCCATGCTAACTTGGCCAAACAGGTAAAAAGATGGTG
 
. : . : . : . : . : . :
rJMSF039N15+ GTTCACTAGTGGACTGAAGATGCACTGGCCCGTTATCCTTCCACTGCAGAGAGGAGGAGG
rJMSF047O14+ GTTCACTAGTGGACTGAAGATGCACTGGCCCGTTATCCTTCCACTGCAGAGAGGAGGAGG
rJMSF013G01+ GTTCACTAGTGGACTGAAGATGCACTGGCCCGTTATCCTTCCACTGCAGAGAGGAGGAGG
                      ____________________________________________________________
consensus GTTCACTAGTGGACTGAAGATGCACTGGCCCGTTATCCTTCCACTGCAGAGAGGAGGAGG
 
. : . : . : . : . : . :
rJMSF039N15+ TCTTCGCTGCTCTGTGAAGCCAGCCTCACGCGGTACCCTCCGATCTAAGGACAGAGAAGT
rJMSF047O14+ TCTTCGCTGCTCTGTGAAGCCAGCCTCACGCGGTACCCTCCGATCTAAGGACAGAGAAGT
rJMSF013G01+ TCTTCGCTGCTCTGTGAAGCCAGCCTCACGCGGTACCCTCCGATCTAAGGACAGAGAAGT
                      ____________________________________________________________
consensus TCTTCGCTGCTCTGTGAAGCCAGCCTCACGCGGTACCCTCCGATCTAAGGACAGAGAAGT
 
. : . : . : . : . : . :
rJMSF039N15+ CTCGACCTTCGTCGAGACTCCTCCGTCAACTCACCACTTGAAATGGGCAAGCCAGAAGAT
rJMSF047O14+ CTCGACCTTCGTCGAGACTCCTCCGTCAACTCACCACTTGAAATGGGCAAGCCAGAAGAT
rJMSF013G01+ CTCGACCTTCGTCGAGACTCCTCCGTCAACTCACCACTTGAAATGGGCAAGCCAGAAGAT
                      ____________________________________________________________
consensus CTCGACCTTCGTCGAGACTCCTCCGTCAACTCACCACTTGAAATGGGCAAGCCAGAAGAT
 
. : . : . : . : . : . :
rJMSF039N15+ AGCATACCAAGCCCGGCCGTCAGGGCAAGCCCAACTGTTCCACCATCTTAATGCTCCCAC
rJMSF047O14+ AGCATACCAAGCCCGGCCGTCAGGGCAAGCCCAACTGTTCCACCATCTTAATGCTCCCAC
rJMSF013G01+ AGCATACCAAGCCCGGCCGTCAGGGCAAGCCCAACTGTTCCACCATCTTAATGCTCCCAC
                      ____________________________________________________________
consensus AGCATACCAAGCCCGGCCGTCAGGGCAAGCCCAACTGTTCCACCATCTTAATGCTCCCAC
 
. : . : . : . : . : . :
rJMSF039N15+ TCGGGTTAAAGGCTCACGCTACCAAGCCCAGCCAGCAATTCTTCTAGCTAGGGACTTATT
rJMSF047O14+ TCGGGTTAAAGGCTCACGCTACCAAGCCCGGCCAGCAATTCTTCTAGCTAGGGACTTATT
rJMSF013G01+ TCGGGTTAAAGGCTCACGCTACCAAGCCCAGCCAGCAATTCTTCTAGCTAGGGACTTATT
                      ____________________________________________________________
consensus TCGGGTTAAAGGCTCACGCTACCAAGCCCAGCCAGCAATTCTTCTAGCTAGGGACTTATT
 
. : . : . : . : . : . :
rJMSF039N15+ AAGAGAACATATTCTTCATCTGGTTTCGATGTGGGATATTGTAAGGGTTGGTTTGGCTTT
rJMSF047O14+ AAGAGAACATATTCTTCATCTGGTTTCGATGTGGGATATTGTAAGGGTTGGTTTGGCTTT
rJMSF013G01+ AAGAGAACATATTCTTCATCTGGTTTCGATGTGGGATATTGTAAGGGTTGGTTTGGCTTT
                      ____________________________________________________________
consensus AAGAGAACATATTCTTCATCTGGTTTCGATGTGGGATATTGTAAGGGTTGGTTTGGCTTT
 
. : . : . : . : . : . :
rJMSF039N15+ CATGGGGAAAAAATGGAGCAGACAACTATTGTGTA
rJMSF047O14+ CATGGGGAAAAAATGGAGCAGACAACTATTGTGTA
rJMSF013G01+ CATGGGGAAAAAATGGAGCAGACAACTATTGTGTACTCACGATTTTTGTGGTGTATCATA
                      ____________________________________________________________
consensus CATGGGGAAAAAATGGAGCAGACAACTATTGTGTACTCACGATTTTTGTGGTGTATCATA