Previous Contig 011729:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002O18Sequence227004459 (3)762011729 (3)gb:BT002394_16359972e-43Arabidopsis thaliana Unknown protein (At1g38131) mRNA, complete cds.
JMSF013C14Sequence392004459 (3)gb:BT002394_16359974e-05Arabidopsis thaliana Unknown protein (At1g38131) mRNA, complete cds.769011729 (3)
JMSF028G19Sequence642004459 (3)gb:BT002394_16359972e-34Arabidopsis thaliana Unknown protein (At1g38131) mRNA, complete cds.760011729 (3)gb:BT002394_16359976e-39Arabidopsis thaliana Unknown protein (At1g38131) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002O18+ TCCTACAGACNAAGGATACACTTGCAA
rJMSF028G19+ GGATACACTTGCCA
                      ____________________________________________________________
consensus TCCTACAGACNAAGGATACACTTGCCA
 
. : . : . : . : . : . :
rJMSF002O18+ CCACTGAGGAGCCTGCTCCATTCCAGAATTACTCATCAAGGTTAGCTGCTCTGGACTATA
rJMSF028G19+ CCACTGAGGAGCTTGCTCCATTCCAGAATTACTCATCAAGGTTAGCTGCTCTGGACTATA
                      ____________________________________________________________
consensus CCACTGAGGAGCTTGCTCCATTCCAGAATTACTCATCAAGGTTAGCTGCTCTGGACTATA
 
. : . : . : . : . : . :
rJMSF002O18+ TGGTATGCTTGTTTAGCGAAGTGTTTGTCACTACTCAAGGAGGAAACTTCCCTCATTTTT
rJMSF028G19+ TGGTATGCTTGTTTAGCGAAGTGTTTGTCACTACTCAAGGAGGAAACTTCCCTCATTTTT
                      ____________________________________________________________
consensus TGGTATGCTTGTTTAGCGAAGTGTTTGTCACTACTCAAGGAGGAAACTTCCCTCATTTTT
 
. : . : . : . : . : . :
rJMSF002O18+ TGATTGGTCATCGGAGATATCTCTATAATGGGCATGCCAAAACTATTAAACCAGACAAAA
rJMSF028G19+ TGATTGGTCATCGGAGATATCTCTATAATGGGCATGCCAAAACTATTAAACCAGACAAAA
                      ____________________________________________________________
consensus TGATTGGTCATCGGAGATATCTCTATAATGGGCATGCCAAAACTATTAAACCAGACAAAA
 
. : . : . : . : . : . :
rJMSF002O18+ TCAAGCTTGTCGCTTTACTACAGAACACAAGCATAAGTTGGAATGATTTCAAAGATCAGA
rJMSF028G19+ TCAAGCTTGTCGCTTTACTACAGAACACAAGCATAAGTTGGAATGATTTCAAAGATCAGA
                      ____________________________________________________________
consensus TCAAGCTTGTCGCTTTACTACAGAACACAAGCATAAGTTGGAATGATTTCAAAGATCAGA
 
. : . : . : . : . : . :
rJMSF002O18+ TGGGATCAATGCTAGCTGAGAGTGATCGCAATAGCATCTTAGTACCGAGAGTGAAGAAGT
rJMSF028G19+ TGGGATCAATGCTAGCTGAGAGTGATCGCAATAGCATCTTAGTACCGAGAGTGAAGAAGT
                      ____________________________________________________________
consensus TGGGATCAATGCTAGCTGAGAGTGATCGCAATAGCATCTTAGTACCGAGAGTGAAGAAGT
 
. : . : . : . : . : . :
rJMSF002O18+ CTTCAAGAAAGGATTCAATCTACTCAAATCCTCTGCCCGAATGCAGTTGTCTCTGGGAAT
rJMSF028G19+ CTTCAAGAAAGGATTCAATCTACTCAAATCCTCTGCCCGAATGCAGTTGTCTCTGGGAAT
                      ____________________________________________________________
consensus CTTCAAGAAAGGATTCAATCTACTCAAATCCTCTGCCCGAATGCAGTTGTCTCTGGGAAT
 
. : . : . : . : . : . :
rJMSF002O18+ CACACAGGTCAAACGCTCTAAAGGGTTCATACCTCATGGTAAATCAATGATTCTCATCCT
rJMSF028G19+ CACACAGGTCAAACGCTCTAAAGGGTTCATACCTCATGGTAAATCAATGATTCTCATCCT
                      ____________________________________________________________
consensus CACACAGGTCAAACGCTCTAAAGGGTTCATACCTCATGGTAAATCAATGATTCTCATCCT
 
. : . : . : . : . : . :
rJMSF002O18+ ATGAACATCAGCATTTGTTTATTTATGCTTTCTCCAGGTAGTGTTAATTGCTATCTCGTG
rJMSF028G19+ ATGAACATCAGCATTTGTTTATTTATGCTTTCTCCAGGTAGTGTTAATTGCTATCTCGTG
                      ____________________________________________________________
consensus ATGAACATCAGCATTTGTTTATTTATGCTTTCTCCAGGTAGTGTTAATTGCTATCTCGTG
 
. : . : . : . : . : . :
rJMSF002O18+ TGTCTCTGTTGAAAGTCATGAACACAATACACAGATAACTGTTTGGGTGTGACTGACGCA
rJMSF028G19+ TGTCTCTGTTGAAAGTCATGAACACAATACACAGATAACTGTTTGGGTGTGACTGACGCA
rJMSF013C14+ AAAGTCATGAACNCCATACACAGATAACTGTTTGGGTGTGACTGACGCA
                      ____________________________________________________________
consensus TGTCTCTGTTGAAAGTCATGAACACAATACACAGATAACTGTTTGGGTGTGACTGACGCA
 
. : . : . : . : . : . :
rJMSF002O18+ TAGTGCAAGGCAATTCTCCGGGCACTAATTTAAGATAAGATCTATGAAACATACCCTCCT
rJMSF028G19+ TAGTGCAAGGCAATTCTCCGGGCACTAATTTAAGATAAGATCTATGAAACATACCCTCCT
rJMSF013C14+ TAGTGCAAGGCAATTCTCCGGGCACTAATTTAAGATAAGATCTATGAAACATACCCTCCT
                      ____________________________________________________________
consensus TAGTGCAAGGCAATTCTCCGGGCACTAATTTAAGATAAGATCTATGAAACATACCCTCCT
 
. : . : . : . : . : . :
rJMSF002O18+ TATAGGTTTTCTAAAATTAGAGATATTGGTTTGTCTCAATAGATGAGAATATGATGTTTC
rJMSF028G19+ TATAGGTTTTCTAAAATTAGAGATATTGGTTTGTCTCAATAGATGAGAATATGATGTTTC
rJMSF013C14+ TATAGGTTTTCTAAAATTAGAGATATTGGTTTGTCTCAATAGATGAGAATATGATGTTTC
                      ____________________________________________________________
consensus TATAGGTTTTCTAAAATTAGAGATATTGGTTTGTCTCAATAGATGAGAATATGATGTTTC
 
. : . : . : . : . : . :
rJMSF002O18+ TCCTAGTGGAGATTGCAGAGGGAGGAATATTTCAAGGTCTGAACATTCGTATTTCCTTCA
rJMSF028G19+ TCCTAGTGGAGATTGCAGAGGGAGGAATATTTCAAGGTCTGAACATTCGTATTTCCTTCA
rJMSF013C14+ TCCTAGTGGAGATTGCAGAGGGAGGAATATTTCAAGGTCTGAACATTCGTATTTCCTTCA
                      ____________________________________________________________
consensus TCCTAGTGGAGATTGCAGAGGGAGGAATATTTCAAGGTCTGAACATTCGTATTTCCTTCA
 
. : . : . : . : . : . :
rJMSF002O18+ CTGCAAAACTT
rJMSF028G19+ CTGCAAAACTT
rJMSF013C14+ CTGCAAAACTTTGCGCAGTTTAAGAATATGAAATTCGGGTAGATTGTATTGTTAGAAGTT
                      ____________________________________________________________
consensus CTGCAAAACTTTGCGCAGTTTAAGAATATGAAATTCGGGTAGATTGTATTGTTAGAAGTT
 
. : . : . : . : . : . :
rJMSF013C14+ TTTACTCTTCTTTTCTTTTTATTTAGTAGTATATTTCAAATAGTGTTTGTTCATGAATTG
                      ____________________________________________________________
consensus TTTACTCTTCTTTTCTTTTTATTTAGTAGTATATTTCAAATAGTGTTTGTTCATGAATTG
 
. : . : . : . : . : . :
rJMSF013C14+ TTTAAGTAATTTTTGTTACTTTTCAAGCCAACGTCAATGACTACATATTTTGGTTATCTT
                      ____________________________________________________________
consensus TTTAAGTAATTTTTGTTACTTTTCAAGCCAACGTCAATGACTACATATTTTGGTTATCTT
 
. : . : . : . : . : . :
rJMSF013C14+ TGATTTTGGAGATTTTATATTGGGAATATATTCAAGTTTTGGTTCCTCTCGCAGATGATG
                      ____________________________________________________________
consensus TGATTTTGGAGATTTTATATTGGGAATATATTCAAGTTTTGGTTCCTCTCGCAGATGATG
 
. : . : . : . : . : . :
rJMSF013C14+ GAGGTGAAATAGCGATATCATTTTAATTTGTTTTGGTATTTTAATTGGCTCGGATAAAAG
                      ____________________________________________________________
consensus GAGGTGAAATAGCGATATCATTTTAATTTGTTTTGGTATTTTAATTGGCTCGGATAAAAG
 
. : . : . : . : . : . :
rJMSF013C14+ AAGCAAATTAACCAAAATTTGAAATCTTGAGAATTGATGGGGATATGAGTTATGGGCTGA
                      ____________________________________________________________
consensus AAGCAAATTAACCAAAATTTGAAATCTTGAGAATTGATGGGGATATGAGTTATGGGCTGA
 
. : . : . : . : . : . :
rJMSF013C14+ ACTTGGTGGGCTTGGTCTGATCCAGTAGAAGAAAAGGTGGGTCGAGGGAGGTGAGTCAGG
                      ____________________________________________________________
consensus ACTTGGTGGGCTTGGTCTGATCCAGTAGAAGAAAAGGTGGGTCGAGGGAGGTGAGTCAGG
 
. : . : . : . : . : . :
rJMSF013C14+ GCACGGATGGGTGTCGGCAAATTATTGTAATGGACCAATGGACCATGGTCAGACCATGAA
                      ____________________________________________________________
consensus GCACGGATGGGTGTCGGCAAATTATTGTAATGGACCAATGGACCATGGTCAGACCATGAA
 
. : . : . : . : . : . :
rJMSF013C14+ TATTAGGTACATTTTTAATATATTATAAGTACATATTTTTGTATTGAAGAGACATTATTG
                      ____________________________________________________________
consensus TATTAGGTACATTTTTAATATATTATAAGTACATATTTTTGTATTGAAGAGACATTATTG