Previous Contig 011720:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012P12Sequence454011720 (2)sp|O82221|RUXG_ARATH3e-32Probable small nuclear ribonucleoprotein G (snRNP-G) (Sm protein G) (Sm-G) (SmG)475011720 (2)sp|O82221|RUXG_ARATH3e-32Probable small nuclear ribonucleoprotein G (snRNP-G) (Sm protein G) (Sm-G) (SmG)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012P12- GGTTCTGTTCCTTCTTCGTTTTCCCTCTCCTGGTGAAGTAAAAGCTGTTAGGGTT
rJMSF012P12+ GGTTCTGTTCCTTCTTCGTTTTCCCTCTCCTGGTGAAGTAAAAGCTGTTAGGGTT
                      ____________________________________________________________
consensus GGTTCTGTTCCTTCTTCGTTTTCCCTCTCCTGGTGAAGTAAAAGCTGTTAGGGTT
 
. : . : . : . : . : . :
JMSF012P12- TAACGATGAGCCGATCGGGTCAACCGCCGGATCTCAAGAAGTACATGGACAAGAAGCTGC
rJMSF012P12+ TAACGATGAGCCGATCGGGTCAACCGCCGGATCTCAAGAAGTACATGGACAAGAAGCTGC
                      ____________________________________________________________
consensus TAACGATGAGCCGATCGGGTCAACCGCCGGATCTCAAGAAGTACATGGACAAGAAGCTGC
 
. : . : . : . : . : . :
JMSF012P12- AAATCAAGTTAAATGCTAACAGAATGGTGGTTGGAACACTTAGGGGTTTTGATCAGTTCA
rJMSF012P12+ AAATCAAGTTAAATGCTAACAGAATGGTGGTTGGAACACTTAGGGGTTTTGATCAGTTCA
                      ____________________________________________________________
consensus AAATCAAGTTAAATGCTAACAGAATGGTGGTTGGAACACTTAGGGGTTTTGATCAGTTCA
 
. : . : . : . : . : . :
JMSF012P12- TGAATCTGGTTGTGGACAACACCGTTGAAGTAAATGGCAATGAAAGAACTGACATTGGCA
rJMSF012P12+ TGAATCTGGTTGTGGACAACACCGTTGAAGTAAATGGCAATGAAAGAACTGACATTGGCA
                      ____________________________________________________________
consensus TGAATCTGGTTGTGGACAACACCGTTGAAGTAAATGGCAATGAAAGAACTGACATTGGCA
 
. : . : . : . : . : . :
JMSF012P12- TGGTGGTCCTTAGGGGGAACAGTGTGGTTACCATTGAAGCACTTGAACCTTTGCCAGAAC
rJMSF012P12+ TGGTGGTCCTTAGGGGGAACAGTGTGGTTACCATTGAAGCACTTGAACCTTTGCCAGAAC
                      ____________________________________________________________
consensus TGGTGGTCCTTAGGGGGAACAGTGTGGTTACCATTGAAGCACTTGAACCTTTGCCAGAAC
 
. : . : . : . : . : . :
JMSF012P12- TTAGTCATTTGCATCACAGGATGGTAACTTTCAATGTATTGTGTAGTTAAAGTTCACTAC
rJMSF012P12+ TTAGTCATTTGCATCACAGGATGGTAACTTTCAATGTATTGTGTAGTTAAAGTTCACTAC
                      ____________________________________________________________
consensus TTAGTCATTTGCATCACAGGATGGTAACTTTCAATGTATTGTGTAGTTAAAGTTCACTAC
 
. : . : . : . : . : . :
JMSF012P12- TTCAGATCTTGTACCATGAACTAACTGATACAAAAGTTATCAAATTGAAATACATTGAAT
rJMSF012P12+ TTCAGATCTTGTACCATGAACTAACTGATACAAAAGTTATCAAATTGAAATACATTGAAT
                      ____________________________________________________________
consensus TTCAGATCTTGTACCATGAACTAACTGATACAAAAGTTATCAAATTGAAATACATTGAAT
 
. : . : . : . : . : . :
JMSF012P12- TGTATTGAAGAGCATGATTGTT-CAGTGTTAAAC
rJMSF012P12+ TGTATTGAAGAGCATGATTGTTCCAGTGTTAAACCAGAAGTTTGGTGGACGAATGGATGT
                      ____________________________________________________________
consensus TGTATTGAAGAGCATGATTGTTCCAGTGTTAAACCAGAAGTTTGGTGGACGAATGGATGT