Previous Contig 011718:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012P02Sequence393005354 (5)776011718 (2)sp|P11043|AROA_PETHY2e-903-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19
JMSF053M17Sequence582005354 (5)907011718 (2)sp|P11043|AROA_PETHYe-1103-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF053M17+ CCTTACGTTGAAATGACTATTAAAGTTGAT
                      ____________________________________________________________
consensus CCTTACGTTGAAATGACTATTAAAGTTGAT
 
. : . : . : . : . : . :
rJMSF053M17+ GGAGCGGTTNGGGGTCAGTGTAGAGCATAGTGACAGCTGGGACAGGTTCTTGATCCGCGG
                      ____________________________________________________________
consensus GGAGCGGTTNGGGGTCAGTGTAGAGCATAGTGACAGCTGGGACAGGTTCTTGATCCGCGG
 
. : . : . : . : . : . :
rJMSF053M17+ AGGTCAGAAATACAAGTCTCCCGGTAATGCTTTCGTGGAAGGTGATGCTTCGAGTGCGAG
                      ____________________________________________________________
consensus AGGTCAGAAATACAAGTCTCCCGGTAATGCTTTCGTGGAAGGTGATGCTTCGAGTGCGAG
 
. : . : . : . : . : . :
rJMSF053M17+ TTATTTCTTAGCCGGTGCAGCTGTTACTGGGGGTACTGTTACCGTTGAAGGTTGTGGAAC
rJMSF012P02+ TTCTTAGCCGGTGCAGCTGTTACTGGGGGTACTGTTACCGTTGAAGGTTGTGGAAC
                      ____________________________________________________________
consensus TTATTTCTTAGCCGGTGCAGCTGTTACTGGGGGTACTGTTACCGTTGAAGGTTGTGGAAC
 
. : . : . : . : . : . :
rJMSF053M17+ AAGCAGTTTACAGGGGGATGTTAAGTTTGCTGAGGTTCTCGAGAAGATGGGAGCCGAAG-
rJMSF012P02+ AAGCAGTTTACAGGGGGATGTTAAGTTTGCTGAGGTTCTCGAGAAGATGGGAGCCGAAGT
                      ____________________________________________________________
consensus AAGCAGTTTACAGGGGGATGTTAAGTTTGCTGAGGTTCTCGAGAAGATGGGAGCCGAAGT
 
. : . : . : . : . : . :
rJMSF053M17+ TTCCTGGACAGAGAACAGTGTTACCGTGAAAGGACCACCACGTGCCCCTTCGGGAAGAAA
rJMSF012P02+ TTCCTGGACAGAGAACAGTGTTACCGTGAAAGGACCACCACGTGCCCCTTCGGGAAGAAA
                      ____________________________________________________________
consensus TTCCTGGACAGAGAACAGTGTTACCGTGAAAGGACCACCACGTGCCCCTTCGGGAAGAAA
 
. : . : . : . : . : . :
rJMSF053M17+ ACACTTACGTGCCATTGATGTCAACATGAACAAAATGCCAGATGTTGCCATGACTCTTGC
rJMSF012P02+ ACACTTACGTGCCATTGATGTCAACATGAACAAAATGCCAGATGTTGCCATGACTCTTGC
                      ____________________________________________________________
consensus ACACTTACGTGCCATTGATGTCAACATGAACAAAATGCCAGATGTTGCCATGACTCTTGC
 
. : . : . : . : . : . :
rJMSF053M17+ TGTAGTTGCGCTATTTGCTGACGGTCCGACAGCCATAAGAGACGTTGCGAGCTGGAGAGT
rJMSF012P02+ TGTAGTTGCGCTATTTGCTGACGGTCCGACAGCCATAAGAGACGTTGCGAGCTGGAGAGT
                      ____________________________________________________________
consensus TGTAGTTGCGCTATTTGCTGACGGTCCGACAGCCATAAGAGACGTTGCGAGCTGGAGAGT
 
. : . : . : . : . : . :
rJMSF053M17+ TAAGGAAACCGAGCGGATGATTGCTGTATGCACTGAACTTAGAAAGCTGGGAGCGACAGT
rJMSF012P02+ TAAGGAAACCGAGCGGATGATTGCTGTATGCACTGAACTTAGAAAGCTGGGAGCGACAGT
                      ____________________________________________________________
consensus TAAGGAAACCGAGCGGATGATTGCTGTATGCACTGAACTTAGAAAGCTGGGAGCGACAGT
 
. : . : . : . : . : . :
rJMSF053M17+ CGAGGAAGGGCCAGACTACTGTATAATCACGCCACCCGAGAGACTAAACGTGACAGAAAT
rJMSF012P02+ CGAGGAAGGGCCAGACTACTGTATAATCACGCCACCCGAGAGACTAAACGTGACAGAGAT
                      ____________________________________________________________
consensus CGAGGAAGGGCCAGACTACTGTATAATCACGCCACCCGAGAGACTAAACGTGACAGAGAT
 
. : . : . : . : . : . :
rJMSF053M17+ CGACACGTACGACGATCACAGAATGGCCATGGCGTTTTCTCTTGCTGCTTGTGCAGAGGT
rJMSF012P02+ CGACACGTACGACGATCACAGAATGGCCATGGCGTTTTCTCTTGCTGCTTGTGCAGAGGT
                      ____________________________________________________________
consensus CGACACGTACGACGATCACAGAATGGCCATGGCGTTTTCTCTTGCTGCTTGTGCAGAGGT
 
. : . : . : . : . : . :
rJMSF053M17+ ACCAGTCACCATTAAAGATCCTGGTTGTACCCGCAAGACTTTCCCAGATTATTTCGAGGT
rJMSF012P02+ ACCAGTCACCATTAAAGATCCTGGTTGTACCCGCAAGACTTTCCCAGATTATTTCGAGGT
                      ____________________________________________________________
consensus ACCAGTCACCATTAAAGATCCTGGTTGTACCCGCAAGACTTTCCCAGATTATTTCGAGGT
 
. : . : . : . : . : . :
rJMSF053M17+ CCTTCAGAAGTTCTCCAAGCATTAAAGGTTTCCTTTTCATCGATTTTGGAAGGTAGAGAA
rJMSF012P02+ CCTTCAGAAGTTCTCCAAGCATTAAAGGTTTCCTTTTCATCGATTTTGGAAGGTAGAGAA
                      ____________________________________________________________
consensus CCTTCAGAAGTTCTCCAAGCATTAAAGGTTTCCTTTTCATCGATTTTGGAAGGTAGAGAA
 
. : . : . : . : . : . :
rJMSF053M17+ CGGTGTTAGTTGAAAGAGTTACTCGGAACTACCATGTTCCTCTTAGTTATGGTT
rJMSF012P02+ CGGTGTTAGTTGAAAGAGTTACTCGGAACTACCATGTTCCTCTTAGTTATGGTTAAACAT
                      ____________________________________________________________
consensus CGGTGTTAGTTGAAAGAGTTACTCGGAACTACCATGTTCCTCTTAGTTATGGTTAAACAT
 
. : . : . : . : . : . :
rJMSF012P02+ CAAGAATGTGTACTGTGTTCTTTATTCATGTTTCCAGATCTGTTATAACTGGTCTGAACA
                      ____________________________________________________________
consensus CAAGAATGTGTACTGTGTTCTTTATTCATGTTTCCAGATCTGTTATAACTGGTCTGAACA
 
. : . : . : . : . : . :
rJMSF012P02+ AAGACCATTTTGAATCTCAATATTGTATTTGGAGTTATGGTTCTTGTATTATACTGATGA
                      ____________________________________________________________
consensus AAGACCATTTTGAATCTCAATATTGTATTTGGAGTTATGGTTCTTGTATTATACTGATGA