Previous Contig 011717:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012P01Sequence412007539 (6)762011717 (3)gb:AP006062_18607356e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041
JMSF021P19Sequence650007539 (6)gb:AP006062_18607353e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041740011717 (3)gb:AP006062_18607359e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041
JMSF043E16Sequence764007539 (6)gb:AP006062_18607351e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041744011717 (3)gb:AP006062_18607354e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021P19+ TCCATTCCAGATTATG
                      ____________________________________________________________
consensus TCCATTCCAGATTATG
 
. : . : . : . : . : . :
rJMSF021P19+ AAGATATTTGTAGAAAAGAAAATCAGATGCTTGAGCAAGCCCTTTTGGCAGATCTGGCTT
                      ____________________________________________________________
consensus AAGATATTTGTAGAAAAGAAAATCAGATGCTTGAGCAAGCCCTTTTGGCAGATCTGGCTT
 
. : . : . : . : . : . :
rJMSF021P19+ ATGTAGAGCTTGAACTGGGGGATCCATTGAGGGCTCTATCAACAGCAAGATCTCTATTGA
                      ____________________________________________________________
consensus ATGTAGAGCTTGAACTGGGGGATCCATTGAGGGCTCTATCAACAGCAAGATCTCTATTGA
 
. : . : . : . : . : . :
rJMSF021P19+ AACTCATTGAATGTTCCAAGATATATACCTTCTTGGGTAATGTCTATGCAGCTGAGGCTC
                      ____________________________________________________________
consensus AACTCATTGAATGTTCCAAGATATATACCTTCTTGGGTAATGTCTATGCAGCTGAGGCTC
 
. : . : . : . : . : . :
rJMSF021P19+ TATGCTTGCTTAGCCGGCCAAAGGAGGCTGCGGAACATTTGTCAATGTATCTTTCTGAGA
rJMSF043E16+ TTTCTGAGA
rJMSF012P01+ CCAAAGGAGGCTGCGGAACATTTGTCAATGTATCTTTCTGAGA
                      ____________________________________________________________
consensus TATGCTTGCTTAGCCGGCCAAAGGAGGCTGCGGAACATTTGTCAATGTATCTTTCTGAGA
 
. : . : . : . : . : . :
rJMSF021P19+ TTAA-GGGTGTTGAACAGCCATTTAGTCAGGAGGATGTGGAAGCATGGAGAGTGGAGAAG
rJMSF043E16+ TTAAGGGGTGTTGAACAGCCATTTAGTCAGGAGGATGTGGAAGCATGGAGAGTGGAGAAG
rJMSF012P01+ TTAA-GGGTGTTGAACAGCCATTTAGTCAGGAGGATGTGGAAGCATGGAGAGTGGAGAAG
                      ____________________________________________________________
consensus TTAA-GGGTGTTGAACAGCCATTTAGTCAGGAGGATGTGGAAGCATGGAGAGTGGAGAAG
 
. : . : . : . : . : . :
rJMSF021P19+ GTAGTGGATTCAGAGGAGTCAAATGGTGGCTCAACAACTATGAACGAATCTCAAGGTTTT
rJMSF043E16+ GTAGTGGATTCAGAGGAGTCAAATGGTGGCTCAACAACTATGAACGAATCTCAAGGTTTT
rJMSF012P01+ GTAGTGGATTCAGAGGAGTCAAATGGTGGCTCAACAACTATGAACGAATCTCAAGGTTTT
                      ____________________________________________________________
consensus GTAGTGGATTCAGAGGAGTCAAATGGTGGCTCAACAACTATGAACGAATCTCAAGGTTTT
 
. : . : . : . : . : . :
rJMSF021P19+ GTGTTCCTTAAACCAGAAGAGGCTCGAGGTATTCTGTTTACCAACTTGGCTGCCATGTCT
rJMSF043E16+ GTGTTCCTTAAACCAGAAGAGGCTCGAGGTATTCTGTTTACCAACTTGGCTGCCATGTCT
rJMSF012P01+ GTGTTCCTTAAACCAGAAGAGGCTCGAGGTATTCTGTTTACCAACTTGGCTGCCATGTCT
                      ____________________________________________________________
consensus GTGTTCCTTAAACCAGAAGAGGCTCGAGGTATTCTGTTTACCAACTTGGCTGCCATGTCT
 
. : . : . : . : . : . :
rJMSF021P19+ GCAGTTCAGGGGGATCTTGACCAGGCGCATGCATATGCACTAGCAGCAGCGGCAATCATA
rJMSF043E16+ GCAGTTCAGGGGGATCTTGACCAGGCGCATGCATATGCACTAGCAGCAGCGGCAATCATA
rJMSF012P01+ GCAGTTCAGGGGGATCTTGACCAGGCGCATGCATATGCACTAGCAGCAGCGGCAATCATA
                      ____________________________________________________________
consensus GCAGTTCAGGGGGATCTTGACCAGGCGCATGCATATGCACTAGCAGCAGCGGCAATCATA
 
. : . : . : . : . : . :
rJMSF021P19+ CCCAGGAGTACCAAAGCTATACTCACTGCAATTTATGTTGACCTTTTGCAAGGGAAGACA
rJMSF043E16+ CCCAGGAGTACCAAAGCTATACTCACTGCAATTTATGTTGACCTTTTGCAAGGGAAGACA
rJMSF012P01+ CCCAGGAGTACCAAAGCTATACTCACTGCAATTTATGTTGACCTTTTGCAAGGGAAGACA
                      ____________________________________________________________
consensus CCCAGGAGTACCAAAGCTATACTCACTGCAATTTATGTTGACCTTTTGCAAGGGAAGACA
 
. : . : . : . : . : . :
rJMSF021P19+ AAAGAAGCTGTTGCCAAGTTAAGAAAATGTAGTTCTGTTAGATTCATTCACAACAGCCTA
rJMSF043E16+ AAAGAAGCTGTTGCCAAGTTAAGAAAATGTAGTTCTGTTAGATTCATTCACAACAGCCTA
rJMSF012P01+ AAAGAAGCTGTTGCCAAGTTAAGAAAATGTAGTTCTGTTAGATTCATTCACAACAGCCTA
                      ____________________________________________________________
consensus AAAGAAGCTGTTGCCAAGTTAAGAAAATGTAGTTCTGTTAGATTCATTCACAACAGCCTA
 
. : . : . : . : . : . :
rJMSF021P19+ CCCACAAATGGTTCTTTATGATGATGATGATTGTATTGGTAGTTTTCACTGGTTGTGTCA
rJMSF043E16+ CCCACAAATGGTTCTTTATGATGATGATGATTGTATTGGTAGTTTTCACTGGTTGTGTCA
rJMSF012P01+ CCCACAAATGGTTCTTTATGATGATGATGATTGTATTGGTAGTTTTCACTGGTTGTGTCA
                      ____________________________________________________________
consensus CCCACAAATGGTTCTTTATGATGATGATGATTGTATTGGTAGTTTTCACTGGTTGTGTCA
 
. : . : . : . : . : . :
rJMSF021P19+ AGCCCACCCTTCTTCACATCAGGTTAGAAGGTAGTCTGACAATCCCTATATAGGTGATTT
rJMSF043E16+ AGCCCACCCTTCTTCACATCAGGTTAGAAGGTAGTCTGACAATCCCTATATAGGTGATTT
rJMSF012P01+ AGCCCACCCTTCTTCACATCAGGTTAGAAGGTAGTCTGACAATCCCTATATAGGTGATTT
                      ____________________________________________________________
consensus AGCCCACCCTTCTTCACATCAGGTTAGAAGGTAGTCTGACAATCCCTATATAGGTGATTT
 
. : . : . : . : . : . :
rJMSF021P19+ GTACC
rJMSF043E16+ GTACCATATATAGTTCATCCCAGGAATAAGTTTTCATTTGTAACTTTTCAATTTTACATA
rJMSF012P01+ GTACCATATATAGTTCATCCCAGGAATAAGTTTTCATTTGTAACTTTTCAATTTTACATA
                      ____________________________________________________________
consensus GTACCATATATAGTTCATCCCAGGAATAAGTTTTCATTTGTAACTTTTCAATTTTACATA
 
. : . : . : . : . : . :
rJMSF043E16+ TTCAGTTGTAGGTTTATTTTGGTTGGGGGGTGAGGGGGGGAGTGGGTGCAGAGATTATTT
rJMSF012P01+ TTCAGTTGTAGGTTTATTTTGGTTGGGGGGTGAGGGGGGGAGTGGGTGCAGAGATTATTT
                      ____________________________________________________________
consensus TTCAGTTGTAGGTTTATTTTGGTTGGGGGGTGAGGGGGGGAGTGGGTGCAGAGATTATTT
 
. : . : . : . : . : . :
rJMSF043E16+ TGGCTGTTGCAGATGCCACCACCTATAAGAGATTTGAGATCTGTAATTTTTGTTTTAGAG
rJMSF012P01+ TGGCTGTTGCAGATGCCACCACCTATAAGAGATTTGAGATCTGTAGTTTTTGTTTTAGAG
                      ____________________________________________________________
consensus TGGCTGTTGCAGATGCCACCACCTATAAGAGATTTGAGATCTGTAGTTTTTGTTTTAGAG
 
. : . : . : . : . : . :
rJMSF043E16+ AGCTGTGTTTTCTAGAGTCTAATTTTAGCTTCCCGTTCCAACCTTCCAAAGGTATAGAGT
rJMSF012P01+ AGCTGTGTTTTCTAGAGTCTAATTTTAGCTTCCCGTTCCAACCTTCCAAAGGTATAGAGT
                      ____________________________________________________________
consensus AGCTGTGTTTTCTAGAGTCTAATTTTAGCTTCCCGTTCCAACCTTCCAAAGGTATAGAGT