Previous Contig 011714:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003J02Sequence135004532 (2)533011714 (8)gb:AY389755_11783625e-26Hyacinthus orientalis ribonucleoside-diphosphate reductase R2 mRNA, partial cds.
JMSF012O09Sequence310007894 (2)762011714 (8)sp|P49730|RIR2_TOBACe-100Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r
JMSF027K11Sequence676011714 (8)sp|P49730|RIR2_TOBACe-101Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r759011714 (8)sp|P49730|RIR2_TOBACe-111Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r
JMSF032K04Sequence720011714 (8)sp|P49730|RIR2_TOBACe-111Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r707011714 (8)sp|P49730|RIR2_TOBACe-105Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r
JMSF044P01Sequence723011714 (8)sp|P49730|RIR2_TOBACe-111Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r760011714 (8)sp|P49730|RIR2_TOBACe-105Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003J02- GAACTTCAAGATCTTAGCTTTAATCAAGAAAAAGAAGAATTAAA
                      ____________________________________________________________
consensus GAACTTCAAGATCTTAGCTTTAATCAAGAAAAAGAAGAATTAAA
 
. : . : . : . : . : . :
rJMSF003J02- AGATCTCAACTTTAATCAAGAAGAAAAAAAAAAAACCATCNCTTCNCTTCTTCATNGNCT
JMSF027K11- CT
JMSF044P01- CT
JMSF032K04- CT
                      ____________________________________________________________
consensus AGATCTCAACTTTAATCAAGAAGAAAAAAAAAAAACCATCNCTTCNCTTCTTCATNGNCT
 
. : . : . : . : . : . :
rJMSF003J02- CAAAGCCCTAGCAATCCCTAGATCCAATTTCGCTGAANAAAANGCCTTCGATTCCGGAAN
JMSF027K11- CAAAGCCCTAGCAATCCCTAGATTCGATTTCGCTGAAGAAAATGCCTTCGATTCCGGAAG
JMSF044P01- CAAAGCCCTAGCAATCCCTAGATTCGATTTCGCTGAAGAAAATGCCTTCGATTCCGGAAG
JMSF032K04- CAAAGCCCTAGCAATCCCTAGATTCGATTTCGCTGAAGAAAATGCCTTCGATTCCGGAAG
                      ____________________________________________________________
consensus CAAAGCCCTAGCAATCCCTAGATTCGATTTCGCTGAAGAAAATGCCTTCGATTCCGGAAG
 
. : . : . : . : . : . :
rJMSF003J02- AGCCTCTTCTCGCCCCCAATCCANACCGATTCNGTANGTTCCCGATNGAGTACCCGCAAA
JMSF027K11- AGCCTCTTCTCGCCCCCAATCCGGACCGCTTCTGTATGTTCCCGATTGAGTACCCGCAAA
JMSF044P01- AGCCTCTTCTCGCCCCCAATCCGGACCGCTTCTGTATGTTCCCGATTGAGTACCCGCAAA
JMSF032K04- AGCCTCTTCTCGCCCCCAATCCGGACCGCTTCTGTATGTTCCCGATTGAGTACCCGCAAA
                      ____________________________________________________________
consensus AGCCTCTTCTCGCCCCCAATCCGGACCGCTTCTGTATGTTCCCGATTGAGTACCCGCAAA
 
. : . : . : . : . : . :
rJMSF003J02- TCNGGGNGATGTATAANAAAGCTGTTGCGTCTTTCNGGACGGGGGAGGAGGTCGATCTCT
JMSF027K11- TCTGGGAGATGTACAAGAAAGCCGTCGCGTCTTTCTGGACGGCGGAGGAGGTTGATCTCT
JMSF044P01- TCTGGGAGATGTACAAGAAAGCCGTCGCGTCTTTCTGGACGGCGGAGGAGGTTGATCTCT
JMSF032K04- TCTGGGAGATGTACAAGAAAGCCGTCGCGTCTTTCTGGACGGCGGAGGAGGTTGATCTCT
                      ____________________________________________________________
consensus TCTGGGAGATGTACAAGAAAGCCGTCGCGTCTTTCTGGACGGCGGAGGAGGTTGATCTCT
 
. : . : . : . : . : . :
rJMSF003J02- CTCAGGATCNCCGTCAGGGGGAAGCCCTAACCTCTGANAATTGAAACNCTTTATTAAACN
JMSF027K11- CTCAGGATCTCCGTCAGTGGGAAGCCCTAACCTCCGACGA--GAAGCACTTTATTAAGCA
JMSF044P01- CTCAGGATCTCCGTCAGTGGGAAGCCCTAACCTCCGACGA--GAAGCACTTTATTAAGCA
JMSF032K04- CTCAGGATCTCCGTCAGTGGGAAGCCCTAACCTCCGACGA--GAAGCACTTTATTAAGCA
                      ____________________________________________________________
consensus CTCAGGATCTCCGTCAGTGGGAAGCCCTAACCTCCGACGA--GAAGCACTTTATTAAGCA
 
. : . : . : . : . : . :
rJMSF003J02- CGTACTTGCCTTTTTTGCCGCCNCCNACNACNTCGTTTTGGANAATCTTGCTGGACGGTT
JMSF027K11- CATACTTGCCTTTTTTGCCGCCTCCGACGGCATCGTTTTGGAGAATCTCGCCGGACGGTT
JMSF044P01- CATACTTGCCTTTTTTGCCGCCTCCGACGGCATCGTTTTGGAGAATCTCGCCGGACGGTT
JMSF032K04- CATACTTGCCTTTTTTGCCGCCTCCGACGGCATCGTTTTGGAGAATCTCGCCGGACGGTT
                      ____________________________________________________________
consensus CATACTTGCCTTTTTTGCCGCCTCCGACGGCATCGTTTTGGAGAATCTCGCCGGACGGTT
 
. : . : . : . : . : . :
rJMSF003J02- GATGAAGGAGGTCTANATTACGGAGGCGCGGGCATTTTATGGATTCTAGACCNCCATTGA
JMSF027K11- CATGAAGGAGGTCCAGGTTGCGGAGGCGCGTGCGTTTTACGGATTCCAGATCGCCATCGA
JMSF044P01- CATGAAGGAGGTCCAGGTTGCGGAGGCGCGTGCGTTTTACGGATTCCAGATCGCCATCGA
JMSF032K04- CATGAAGGAGGTCCAGGTTGCGGAGGCGCGTGCGTTTTACGGATTCCAGATCGCCATCGA
                      ____________________________________________________________
consensus CATGAAGGAGGTCCAGGTTGCGGAGGCGCGTGCGTTTTACGGATTCCAGATCGCCATCGA
 
. : . : . : . : . : . :
rJMSF003J02- GAATATCCA
JMSF027K11- GAATATCCACTCTGAGATGTACAGTCTTCTGTTGGAGACTTACATCAAGGATTCTGAAGA
JMSF044P01- GAATATCCACTCTGAGATGTACAGTCTTCTGTTGGAGACTTACATCAAGGATTCTGAAGA
JMSF032K04- GAATATCCACTCTGAGATGTACAGTCTTCTGTTGGAGACTTACATCAAGGATTCTGAAGA
rJMSF044P01+ TCTGAGATGTACAGTCTTCTGTTGGAGACTTACATCAAGGATTCTGAAGA
rJMSF032K04+ CATCAAGGATTCTGAAGA
rJMSF027K11+ TCTGAGATGTACAGTCTTCTGTTGGAGACTTACATCAAGGATTCTGAAGA
                      ____________________________________________________________
consensus GAATATCCACTCTGAGATGTACAGTCTTCTGTTGGAGACTTACATCAAGGATTCTGAAGA
 
. : . : . : . : . : . :
JMSF027K11- GAAGGACAGGTTGTTCCACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
JMSF044P01- GAAGGACAGGTTGTTCCACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
JMSF032K04- GAAGGACAGGTTGTTCCACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
rJMSF044P01+ GAAGGACAGGTTGTTCCACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
rJMSF032K04+ GAAGGACAGGTTGTTCCACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
rJMSF027K11+ GAAGGACAGGTTGTTCCACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
rJMSF012O09+ CACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
                      ____________________________________________________________
consensus GAAGGACAGGTTGTTCCACGCGATTGATACTGTGCCCTGTGTGGAGAAGAAGGCTAAGTG
 
. : . : . : . : . : . :
JMSF027K11- GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
JMSF044P01- GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
JMSF032K04- GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
rJMSF044P01+ GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
rJMSF032K04+ GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
rJMSF027K11+ GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
rJMSF012O09+ GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
                      ____________________________________________________________
consensus GGCTCTCCGCTGGATTGATGGCTCGGAATCATTCGCTGAGCGTTTGTTGGCCTTTGCTTG
 
. : . : . : . : . : . :
JMSF027K11- TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
JMSF044P01- TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
JMSF032K04- TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
rJMSF044P01+ TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
rJMSF032K04+ TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
rJMSF027K11+ TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
rJMSF012O09+ TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
                      ____________________________________________________________
consensus TGTTGAGGGGATCTTCTTCTCCGGGAGTTTTTGTGCCATATTCTGGCTGAAAAAGCGCGG
 
. : . : . : . : . : . :
JMSF027K11- TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGA
JMSF044P01- TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGATGAGGGCTTGCACTG
JMSF032K04- TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGATGAGGGCTTGCACTG
rJMSF044P01+ TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGATGAGGGCTTGCACTG
rJMSF032K04+ TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGATGAGGGCTTGCACTG
rJMSF027K11+ TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGATGAGGGCTTGCACTG
rJMSF012O09+ TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGATGAGGGCTTGCACTG
                      ____________________________________________________________
consensus TCTGATGCCGGGGTTGTCCTTCTCGAATGAGTTGATCTCGCGAGATGAGGGCTTGCACTG
 
. : . : . : . : . : . :
JMSF044P01- CGATTTCGCATGCTTGCTCTACGGGCTGCTGA
JMSF032K04- CGATTTCGCATGCTTGCTCTACGGGCTGCTGA
rJMSF044P01+ CGATTTCGCATGCTTGCTCTACGGGCTGCTGAGGAGGAAGTTGAGCGAGGAGCGCGTGAA
rJMSF032K04+ CGATTTCGCATGCTTGCTCTACGGGCTGCTGAGGAGGAAGTTGAGCGAGGAGCGCGTGAA
rJMSF027K11+ CGATTTCGCATGCTTGCTCTACGGGCTGCTGAGGAGGAAGTTGAGCGAGGAGCGCGTGAA
rJMSF012O09+ CGATTTCGCATGCTTGCTCTACGGGCTGCTGAGGAGGAAGTTGAGCGAGGAGCGCGTGAA
                      ____________________________________________________________
consensus CGATTTCGCATGCTTGCTCTACGGGCTGCTGAGGAGGAAGTTGAGCGAGGAGCGCGTGAA
 
. : . : . : . : . : . :
rJMSF044P01+ GTCACTTGTGGCTGAAGCTGTTGATATTGAGAGGGAATTCGTGTGTGACGCGCTTCCCTG
rJMSF032K04+ GTCACTTGTGGCTGAAGCTGTTGATATTGAGAGGGAATTCGTGTGTGACGCGCTTCCCTG
rJMSF027K11+ GTCACTTGTGGCTGAAGCTGTTGATATTGAGAGGGAATTCGTGTGTGACGCGCTTCCCTG
rJMSF012O09+ GTCACTTGTGGCTGAAGCTGTTGATATTGAGAGGGAATTCGTGTGTGACGCGCTTCCCTG
                      ____________________________________________________________
consensus GTCACTTGTGGCTGAAGCTGTTGATATTGAGAGGGAATTCGTGTGTGACGCGCTTCCCTG
 
. : . : . : . : . : . :
rJMSF044P01+ TGCTTTGGTGGGGATGAATGGGGATCTGATGAGCCAATACATAGAATTTGTGGCTGATAG
rJMSF032K04+ TGCTTTGGTGGGGATGAATGGGGATCTGATGAGCCAATACATAGAATTTGTGGCTGATAG
rJMSF027K11+ TGCTTTGGTGGGGATGAATGGGGATCTGATGAGCCAATACATAGAATTTGTGGCTGATAG
rJMSF012O09+ TGCTTTGGTGGGGATGAATGGGGATCTGATGAGCCAATACATAGAATTTGTGGCTGATAG
                      ____________________________________________________________
consensus TGCTTTGGTGGGGATGAATGGGGATCTGATGAGCCAATACATAGAATTTGTGGCTGATAG
 
. : . : . : . : . : . :
rJMSF044P01+ ATTGCTAGGTGCATTGGGATGCAGTAAGATGTACAATGTTCAGAATCCGTTTGATTGGAT
rJMSF032K04+ ATTGCTAGGTGCATTGGGATGCAGTAAGATGTACAATGTTCAGAATCCGTTTGATTGGAT
rJMSF027K11+ ATTGCTAGGTGCATTGGGATGCAGTAAGATGTACAATGTTCAGAATCCGTTTGATTGGAT
rJMSF012O09+ ATTGCTAGGTGCATTGGGATGCAGTAAGATGTACAATGTTCAGAATCCGTTTGATTGGAT
                      ____________________________________________________________
consensus ATTGCTAGGTGCATTGGGATGCAGTAAGATGTACAATGTTCAGAATCCGTTTGATTGGAT
 
. : . : . : . : . : . :
rJMSF044P01+ GGAGCTGATCAGCTTACAGGGAAAGACCAATTTCTTTGAGAAGAGGGTTGGAGAATATCA
rJMSF032K04+ GGAGCTGATCAGCTTACAGGGAAAGACCAATTTCTTTGAGAAGAGGGTTGGAGAATATCA
rJMSF027K11+ GGAGCTGATCAGCTTACAGGGAAAGACCAATTTCTTTGAGAAGAGGGTTGGAGAATATCA
rJMSF012O09+ GGAGCTGATCAGCTTACAGGGAAAGACCAATTTCTTTGAGAAGAGGGTTGGAGAATATCA
                      ____________________________________________________________
consensus GGAGCTGATCAGCTTACAGGGAAAGACCAATTTCTTTGAGAAGAGGGTTGGAGAATATCA
 
. : . : . : . : . : . :
rJMSF044P01+ GAAGGCATCTGTCATGTCTAGCCTGANACGGTAGTGGTGACACCCATGTGTTCAAGTTGG
rJMSF032K04+ GAAGGCATCTGTCATGTCTAGCCTGA-ACGGTAGTGGTGACACCCATGTGTTCAAGTTGG
rJMSF027K11+ GAAGGCATCTGTCATGTCTAGCCTGA-ACGGTAGTGGTGACACCCATGTGTTCAAGTTGG
rJMSF012O09+ GAAGGCATCTGTCATGTCTAGCCTGA-ACGGTAGTGGTGACACCCATGTGTTCAAGTTGG
                      ____________________________________________________________
consensus GAAGGCATCTGTCATGTCTAGCCTGA-ACGGTAGTGGTGACACCCATGTGTTCAAGTTGG
 
. : . : . : . : . : . :
rJMSF044P01+ ATGAAGACTTCTAATTTAGATAGTTTAATTATTTGTTGTCTCTTACCTTGTTTGTAACGT
rJMSF032K04+ ATGAAGACTTCTAATTTAGATAGTTTAATTATTTGTTGTCTCTTACCTTGTTTGTAA-GT
rJMSF027K11+ ATGAAGACTTCTAATTTAGATAGTTTAATTATTTGTTGTCTCTTACCTTGTTTGTAA-GT
rJMSF012O09+ ATGAAGACTTCTAATTTAGATAGTTTAATTATTTGTTGTCTCTTACCTTGTTTGTAA-GT
                      ____________________________________________________________
consensus ATGAAGACTTCTAATTTAGATAGTTTAATTATTTGTTGTCTCTTACCTTGTTTGTAA-GT
 
. : . : . : . : . : . :
rJMSF044P01+ CAACTAAAAGCACAAAAAATGATTCGTATATTGTCTAGTTTCTGTAACGT
rJMSF032K04+ CAACTAAAAGCACAAAAAATGATTCGTATAT
rJMSF027K11+ CAACTAAAAGCACAAAAAATGATTCGTATATTGTCTAGTTTCTGTAACGT
rJMSF012O09+ CAACTAAAAGCACAAAAAATGATTCGTATATTGTCTAGTTTCTGTAACGTTTTTCATTTA
                      ____________________________________________________________
consensus CAACTAAAAGCACAAAAAATGATTCGTATATTGTCTAGTTTCTGTAACGTTTTTCATTTA
 
. : . : . : . : . : . :
rJMSF012O09+ TTTCTATAAAGTATAATTTTCATACGAAATCTTGCTTATGTTGTAGATTTGTTGTTCACT
                      ____________________________________________________________
consensus TTTCTATAAAGTATAATTTTCATACGAAATCTTGCTTATGTTGTAGATTTGTTGTTCACT