Previous Contig 011705:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012L06Sequence545007051 (15)gb:NBE504730_16881674e-42Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp747011705 (2)sp|Q9ZPX1|ARF5_ARATH4e-81Probable ADP-ribosylation factor At2g18390.>pir|G84563|G84563 probable ADP-ribos
JMSF040B23Sequence605007051 (15)gb:NBE504730_16881675e-42Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp814011705 (2)sp|Q9ZPX1|ARF5_ARATH3e-78Probable ADP-ribosylation factor At2g18390.>pir|G84563|G84563 probable ADP-ribos

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040B23+ AGCCACAACATCATCTTTTAGTAACTAGGAGGTCAAGAGAA
                      ____________________________________________________________
consensus AGCCACAACATCATCTTTTAGTAACTAGGAGGTCAAGAGAA
 
. : . : . : . : . : . :
rJMSF040B23+ TGGGACTTCTTAGCATCATCCGAAAGATCAAGAAGAAAGAAAAAGAAATGCGCATTCTTA
rJMSF012L06+ AGAAAGAAAAAGAAATGCGCATTCTTA
                      ____________________________________________________________
consensus TGGGACTTCTTAGCATCATCCGAAAGATCAAGAAGAAAGAAAAAGAAATGCGCATTCTTA
 
. : . : . : . : . : . :
rJMSF040B23+ TGGTGGGACTTGACAACTCAGGCAAGACAACCATAGTTTTGAAAATAAATGGTGAAGACA
rJMSF012L06+ TGGTGGGACTTGACAACTCAGGCAAGACAACCATAGTTTTGAAAATAAATGGTGAAGACA
                      ____________________________________________________________
consensus TGGTGGGACTTGACAACTCAGGCAAGACAACCATAGTTTTGAAAATAAATGGTGAAGACA
 
. : . : . : . : . : . :
rJMSF040B23+ CCAGTGTTATCAGTCCGACACTCGGCTTCAACATCAAAACCATTGCATATCAGAAATATA
rJMSF012L06+ CCAGTGTTATCAGTCCGACACTCGGCTTCAACATCAAAACCATTGCATATCAGAAATATA
                      ____________________________________________________________
consensus CCAGTGTTATCAGTCCGACACTCGGCTTCAACATCAAAACCATTGCATATCAGAAATATA
 
. : . : . : . : . : . :
rJMSF040B23+ CACTAAATATATGGGATGTTGGGGGCCAAAAAACCATAAGGTCCTACTGGAGGAACTACT
rJMSF012L06+ CACTAAATATATGGGATGTTGGGGGCCAAAAAACCATAAGGTCCTACTGGAGGAACTACT
                      ____________________________________________________________
consensus CACTAAATATATGGGATGTTGGGGGCCAAAAAACCATAAGGTCCTACTGGAGGAACTACT
 
. : . : . : . : . : . :
rJMSF040B23+ TTGAACAAACTGACGGTTTGGTGTGGGTTGTGGATAGTTCTGATCTTAGAAGGCTAGATG
rJMSF012L06+ TTGAACAAACTGACGGTTTGGTGTGGGTTGTGGATAGTTCTGATCTTAGAAGGCTAGATG
                      ____________________________________________________________
consensus TTGAACAAACTGACGGTTTGGTGTGGGTTGTGGATAGTTCTGATCTTAGAAGGCTAGATG
 
. : . : . : . : . : . :
rJMSF040B23+ ACTGCAGATATGAATTGCATAATCTTTTGAAAGAAGAGAGGCTATCTGGAGCATCATTAC
rJMSF012L06+ ACTGCAGATATGAATTGCATAATCTTTTGAAAGAAGAGAGGCTATCTGGAGCATCATTAC
                      ____________________________________________________________
consensus ACTGCAGATATGAATTGCATAATCTTTTGAAAGAAGAGAGGCTATCTGGAGCATCATTAC
 
. : . : . : . : . : . :
rJMSF040B23+ TGATTTTTGCAAATAAGCAAGACATACAAGGTTCTCTTTGTCCCGACGAAATAGCTAAGG
rJMSF012L06+ TGATTTTTGCAAATAAGCAAGACATACAAGGTTCTCTTTGTCCCGACGAAATAGCTAAGG
                      ____________________________________________________________
consensus TGATTTTTGCAAATAAGCAAGACATACAAGGTTCTCTTTGTCCCGACGAAATAGCTAAGG
 
. : . : . : . : . : . :
rJMSF040B23+ TGCTTAATCTGGATGCTATGGATAAAACCCGGCACTGGAAAATTGTGGGATGTAGTGCAT
rJMSF012L06+ TGCTTAATCTGGATGCTATGGATAAAACCCGGCACTGGAAAATTGTGGGATGTAGTGCAT
                      ____________________________________________________________
consensus TGCTTAATCTGGATGCTATGGATAAAACCCGGCACTGGAAAATTGTGGGATGTAGTGCAT
 
. : . : . : . : . : . :
rJMSF040B23+ ATACCGGAGAAGGGCTCCTCGAGGGATTTGATTGGTTAGTACAGGACGTTGCCTCTCGGA
rJMSF012L06+ ATACCGGAGAAGGGCTCCTCGAGGGATTTGATTGGTTAGTACAGGACGTTGCCTCTCGGA
                      ____________________________________________________________
consensus ATACCGGAGAAGGGCTCCTCGAGGGATTTGATTGGTTAGTACAGGACGTTGCCTCTCGGA
 
. : . : . : . : . : . :
rJMSF040B23+ TCTATATGCTTGATTAAAATGAATCTTTCATATTAGGCAATTTGTCATCATACTGTGTGA
rJMSF012L06+ TCTATATGCTTGATTAAAATGAATCTTTCATATTAGGCAATTTGTCATCATACTGTGTGA
                      ____________________________________________________________
consensus TCTATATGCTTGATTAAAATGAATCTTTCATATTAGGCAATTTGTCATCATACTGTGTGA
 
. : . : . : . : . : . :
rJMSF040B23+ TTTTAGAGTATAGTTTTCTCACATCCAGTGGCTTGTTTGTTATAATTTGCTTAGTGCCTT
rJMSF012L06+ TTTTAGAGTATAGTTTTCTCACATCCAGTGGCTTGTTTGTTATAATTTGCTTAGTGCCTT
                      ____________________________________________________________
consensus TTTTAGAGTATAGTTTTCTCACATCCAGTGGCTTGTTTGTTATAATTTGCTTAGTGCCTT
 
. : . : . : . : . : . :
rJMSF040B23+ TTTTCTTCTGCTCTTTAATCTTGTGTACACCATGCATAATTGAAACTGAGGCAACTGCAT
rJMSF012L06+ TTTTCTTCTGCTCTTTAATCTTGTGTACACCATGCATAATTGAAACTGAGGCAACTGCAT
                      ____________________________________________________________
consensus TTTTCTTCTGCTCTTTAATCTTGTGTACACCATGCATAATTGAAACTGAGGCAACTGCAT
 
. : . : . : . : . : . :
rJMSF040B23+ TGCTCATTTATGAGGTTTACAGCATAGCTATGTATTTCATAGGTTTGCTCTTT
rJMSF012L06+ TGCTCATTTATGAGGTTTACAGCATAGCTATGTATTTCATAGGTTTGCTCTTTTGTTCTT
                      ____________________________________________________________
consensus TGCTCATTTATGAGGTTTACAGCATAGCTATGTATTTCATAGGTTTGCTCTTTTGTTCTT