Previous Contig 011700:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN032M18Sequence635011700 (7)pir|T48868|T488682e-63zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi
JMSF012J20Sequence357006698 (4)708011700 (7)pir|T48868|T488682e-48zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi
JMSF030O05Sequence697006698 (4)pir|T48868|T488685e-36zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi728011700 (7)pir|T48868|T488681e-52zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi
JMSF038H07Sequence706006698 (4)pir|T48868|T488682e-74zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi905011700 (7)pir|T48868|T488681e-70zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi
JMSF042A15Sequence760006698 (4)pir|T48868|T488684e-81zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi653011700 (7)pir|T48868|T488683e-43zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi
JMSF047B17Sequence676007763 (4)gb:AY221505_15905493e-23Lycopersicon esculentum biotin carboxylase carrier protein (BCCP1) mRNA, complet738011700 (7)pir|T48868|T488683e-53zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi
JMSF047C12Sequence726020370pir|T48868|T488685e-68zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi705011700 (7)pir|T48868|T488687e-54zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038H07+ CTCCTGGTCAGCTATCATAT
                      ____________________________________________________________
consensus CTCCTGGTCAGCTATCATAT
 
. : . : . : . : . : . :
rJMSF038H07+ CCCTTGTCAAGAGCTTCTTTTATTACCAATCCACGTTGGCAAGGTCCTTCAAGTTACACA
                      ____________________________________________________________
consensus CCCTTGTCAAGAGCTTCTTTTATTACCAATCCACGTTGGCAAGGTCCTTCAAGTTACACA
 
. : . : . : . : . : . :
rJMSF038H07+ CCCCTGATTGTTCCTCAAGGGGTAGTATCAGTTCCAGGATTTGCATACAGTGGACAACTT
                      ____________________________________________________________
consensus CCCCTGATTGTTCCTCAAGGGGTAGTATCAGTTCCAGGATTTGCATACAGTGGACAACTT
 
. : . : . : . : . : . :
rJMSF030O05+ GCTGACAGTAGG-AATAGTCAGGCTTATGGA
rJMSF038H07+ GGTTCAGTTTCATCCCCTGAGAGCCAACAGCTGACAGTAGGAAATAGTCAGGCTTATGGA
                      ____________________________________________________________
consensus GGTTCAGTTTCATCCCCTGAGAGCCAACAGCTGACAGTAGGAAATAGTCAGGCTTATGGA
 
. : . : . : . : . : . :
rJMSF030O05+ TTGTCTCGTTCCAGTGAGGTGGCAAACGTGGGATCTCAAGGGATGAATCCTTCTTATCGT
rJMSF042A15+ TTATCGT
rJMSF038H07+ TTGTCTCGTTCCAGTGAGGTGGCAAACGTGGGATCTCAAGGGATGAATCCTTCTTATCGT
rJMSF012J20+ CAGTGAGGTGGCAAACGTGGGATCTCAAGGGATGAATCCTTCTTATCGT
                      ____________________________________________________________
consensus TTGTCTCGTTCCAGTGAGGTGGCAAACGTGGGATCTCAAGGGATGAATCCTTCTTATCGT
 
. : . : . : . : . : . :
rJMSF030O05+ GCTGGTACATTACCTAT-GGGGTATTATGCATTGCAGAGAGAGAACGTCTTCCCTGAACG
rJMSF042A15+ GCTGGTACATTACCTATGGGGGTATTATGCATTGCAGAGAGAGAACGTCTTCCCTGAACG
rJMSF047B17+ AGAGAGAGAACGTCTTCCCTGAACG
rJMSF047C12+ AGAGAGAGAACGTCTTCCCTGAACG
JMFN032M18- AGAGAGAGAATGTCTTCCCTGAACG
rJMSF038H07+ GCTGGTACATTACCTAT-GGGGTATTATGCATTGCAGAGAGAGAACGTCTTCCCTGAACG
rJMSF012J20+ GCTGGTACATTACCTAT-GGGGTATTATGCATTGCAGAGAGAGAACGTCTTCCCTGAACG
                      ____________________________________________________________
consensus GCTGGTACATTACCTAT-GGGGTATTATGCATTGCAGAGAGAGAACGTCTTCCCTGAACG
 
. : . : . : . : . : . :
rJMSF030O05+ ACCAGGTCAGCCAGAGTGCCAATTCTACATGAAGACTGGGGATTGCAAGTTTGGTGCTGT
rJMSF042A15+ ACCAGGTCAGCCAGAATGCCAATTCTACATGAAGACTGGGGATTGCAAGTTTGGTGCTGT
rJMSF047B17+ ACCAGGTCAGCCAGAATGCCAATTCTACATGAAGACTGGGGATTGCAAGTTTGGTGCTGT
rJMSF047C12+ ACCAGGTCAGCCAGAATGCCAATTCTACATGAAGACTGGGGATTGCAAGTTTGGTGCTGT
JMFN032M18- GCCTGGCCAACCAGAATGCCAGTTCTACATGAAGACTGGAGACTGCAAGTTTGGTTCAGT
rJMSF038H07+ ACCAGGTCAGCCAGAATGCCAATTCTACATGAAGACTGGGGATTGCAAGTTTGGTGCTGT
rJMSF012J20+ ACCAGGTCAGCCAGAATGCCAATTCTACATGAAGACTGGGGATTGCAAGTTTGGTGCTGT
                      ____________________________________________________________
consensus ACCAGGTCAGCCAGAATGCCAATTCTACATGAAGACTGGGGATTGCAAGTTTGGTGCTGT
 
. : . : . : . : . : . :
rJMSF030O05+ TTGTAAATTCCATCATCCGAGGGAAAGATTGATTCCTCCTCCTGATTCTTTGTTGAGTCC
rJMSF042A15+ TTGTAAATTCCATCATCCGAGGGAAAGATTGATTCCTCCTCCTGATTCTTTGTTGAGTCC
rJMSF047B17+ TTGTAAATTCCATCATCCGAGGGAAAGATTGATTCCTCCTCCTGATTCTTTGTTGAGTCC
rJMSF047C12+ TTGTAAATTCCATCATCCGAGGGAAAGATTGATTCCTCCTCCTGATTCTTTGTTGAGTCC
JMFN032M18- TTGTAGGTTCCATCATCCGAGGGAAAGACTGATTCCTCCTCCTGATTGTATGCTGAGTCC
rJMSF038H07+ TTGTAAATTCCATCATCCGAGGGAAAGATTGATTCCTCCTCCTGATTCTTTGTTGAGTCC
rJMSF012J20+ TTGTAAATTCCATTATCCGAGGGAAAGATTGATTCCTCCTCCTGATTCTTTGTTGAGTCC
                      ____________________________________________________________
consensus TTGTAAATTCCATCATCCGAGGGAAAGATTGATTCCTCCTCCTGATTCTTTGTTGAGTCC
 
. : . : . : . : . : . :
rJMSF030O05+ AATTGGACTTCCTCTACGCCCAGGAGAACCATTATGTGCTTTTTATTCCCGGTATGGGAT
rJMSF042A15+ AATTGGACTTCCTCTACGCCCAGGAGAACCATTATGTGCTTTTTATTCCCGGTATGGGAT
rJMSF047B17+ AATTGGACTTCCTCTACGCCCAGGAGAACCATTATGTGCTTTTTATTCCCGGTATGGGAT
rJMSF047C12+ AATTGGACTTCCTCTACGCCCAGGAGAACCATTATGTGCTTTTTATTCCCGGTATGGGAT
JMFN032M18- TATTGGGCTTCCCCTACGCCCAGGAGAACCAATTTGTATTTTCTACTCCCGATATGGGAT
rJMSF038H07+ AATTGGACTTCCTCTACGCCCAGGAGAACCATTATGTGCTTTTTATTCCCGGTATGGGAT
rJMSF012J20+ AATTGGACTTCCTCTACGCCCAGGAGAACCATTATGTGCTTTTTATTCCCGGTATGGGAT
                      ____________________________________________________________
consensus AATTGGACTTCCTCTACGCCCAGGAGAACCATTATGTGCTTTTTATTCCCGGTATGGGAT
 
. : . : . : . : . : . :
rJMSF030O05+ ATGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTCACCTACAATAT
rJMSF042A15+ ATGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTCACCTACAATAT
rJMSF047B17+ ATGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTCACCTACAATAT
rJMSF047C12+ ATGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTCACCTACAATAT
JMFN032M18- CTGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTTGCTTACAGTCT
rJMSF038H07+ ATGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTCACCTACAATAT
rJMSF012J20+ ATGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTCACCTACAATAT
                      ____________________________________________________________
consensus ATGCAAGTTTGGTCCAAGTTGCAAGTTTGATCACCCAATGGGAGTTTTCACCTACAATAT
 
. : . : . : . : . : . :
rJMSF030O05+ CTCACCATCATCTACAACTAACGCTCCTACTGTTCGGCATTTCTTGGGTTCTTCATCAGG
rJMSF042A15+ CTCACCATCATCTACAACTAACGCTCCTACTGTTCGGCATTTCTTGGGTTCTTCATCAGG
rJMSF047B17+ CTCACCATCATCTACAACTAACGCTCCTACTGTTCGGCATTTCTTGGGTTCTTCATCAGG
rJMSF047C12+ CTCACCATCATCTACAACTAACGCTCCTACTGTTCGGCATTTCTTGGGTTCTTCATCAGG
JMFN032M18- CTCTCCATCACCTTCAACTGATGCTCCTGCTGGTCAGTTTTTGTTGGGTTCATCATCAGG
rJMSF038H07+ CTCACCATCATCTACAACTAACGCTCCTACTGTTCGGCATTTCTTGGGTTCTTCATCAGG
rJMSF012J20+ CTCACCATCATCTACAACTAACGCTCCTACTGTTCGGCATTTCTTGGGTTCTTCATCAGG
                      ____________________________________________________________
consensus CTCACCATCATCTACAACTAACGCTCCTACTGTTCGGCATTTCTTGGGTTCTTCATCAGG
 
. : . : . : . : . : . :
rJMSF030O05+ AACTGGTACTTTGACTTTGTCTTCAGAAGGTGCTTGTTGAGGCAAGTTCCACGGAGCCCA
rJMSF042A15+ AACTGGTACTTTGACTTTGTCTTCAGAAGGTGCTTGTTGAGGCAAGTTCCACGGAGCCCA
rJMSF047B17+ AACTGGTACTTTGACTTTGTCTTCAGAAGGTGCTTGTTGAGGCAAGTTCCACGGAGCCCA
rJMSF047C12+ AACTGGTACTTTGACTTTGTCTTCAGAAGGTGCTTGTTGAGGCAAGTTCCACGGAGCCCA
JMFN032M18- AACTGGTGCTTTGACTTTGTCTTCAGAAGG-GCTTGTTGA
rJMSF038H07+ AACTGGTACTTTGACTTTGTCTTCAGAAGGTGCTTGTTGAGGCAAGTTCCACGGAGCCCA
rJMSF012J20+ AACTGGTACTTTGACTTTGTCTTCAGAAGGTGCTTGTTGAGGCAAGTTCCACGGAGCCCA
                      ____________________________________________________________
consensus AACTGGTACTTTGACTTTGTCTTCAGAAGGTGCTTGTTGAGGCAAGTTCCACGGAGCCCA
 
. : . : . : . : . : . :
rJMSF030O05+ GGTGACTGTCATTCTCAAAAGTGAGACAGATGCCATCTGGTGGTAATAACATTGACACAG
rJMSF042A15+ GGTGACTGTCATTCTCAAAAGTGAGACAGATGCCATCTGGTGGTAATAACATTGACACAG
rJMSF047B17+ GGTGACTGTCATTCTCAAAAGTGAGACAGATGCCATCTGGTGGTAATAACATTGACACAG
rJMSF047C12+ GGTGACTGTCATTCTCAAAAGTGAGACAGATGCCATCTGGTGGTAATAACATTGACACAG
rJMSF038H07+ GGTGACTGTCATTCTCAAAAGTGAGACAGATGCCATCTGGTGGTAATAACATTGACACAG
rJMSF012J20+ GGTGACTGTCATTCTCAAAAGTGAGACAGATGCCATCTGGTGGTAATAACATTGACACAG
                      ____________________________________________________________
consensus GGTGACTGTCATTCTCAAAAGTGAGACAGATGCCATCTGGTGGTAATAACATTGACACAG
 
. : . : . : . : . : . :
rJMSF030O05+ AAGGATGATCTTCCTCTTGGTTACAGCCAGTATCAGTGTCTTCGAACTCCTTTAGAATTA
rJMSF042A15+ AAGGATGATCTTCCTCTTGGTTACAGCCAGTATCAGTGTCTTCGAACTCCTTTAGAATTA
rJMSF047B17+ AAGGATGATCTTCCTCTTGGTTACAGCCAGTATCAGTGTCTTCGAACTCCTTTAGAATTA
rJMSF047C12+ AAGGATGATCTTCCTCTTGGTTACAGCCAGTATCAGTGTCTTCGAACTCCTTTAGAATTA
rJMSF038H07+ AAGGATGATCTTCCTCTTGGTTACAGCCAGTATCAGTGTCTTCGAACTCCTTTAGAATTA
rJMSF012J20+ AAGGATGATCTTCCTCTTGGTTACAGCCAGTATCAGTGTCTTCGAACTCCTTTAGAATTA
                      ____________________________________________________________
consensus AAGGATGATCTTCCTCTTGGTTACAGCCAGTATCAGTGTCTTCGAACTCCTTTAGAATTA
 
. : . : . : . : . : . :
rJMSF030O05+ ATAACAGTTGCCTGTAAATTCATTTCCATTGTTGGAGATGTACATAATTCTATTAAAGCC
rJMSF042A15+ ATAACAGTTGCCTGTAAATTCATTTCCATTGTTGGAGATGTACATAATTCTATTAAAGCC
rJMSF047B17+ ATAACAGTTGCCTGTAAATTCATTTCCATTGTTGGAGATGTACATAATTCTATTAAAGCC
rJMSF047C12+ ATAACAGTTGCCTGTAAATTCATTTCCATTGTTGGAGATGTACATAATTCTAT
rJMSF038H07+ ATAACAGTTGCCTGTAAATTCATTTCCATTGTTGGAGATGTACATAATTCTATTAAAGCC
rJMSF012J20+ ATAACAGTTGCCTGTAAATTCATTTCCATTGTTGGAGATGTACATAATTCTATTAAAGCC
                      ____________________________________________________________
consensus ATAACAGTTGCCTGTAAATTCATTTCCATTGTTGGAGATGTACATAATTCTATTAAAGCC
 
. : . : . : . : . : . :
rJMSF030O05+ ATTCTGTGCTGATAATGCATTCACTTGACAATGTTGATG
rJMSF042A15+ ATTCTGTGCTGATAATGCATTCACTTGACAATGTTGAT
rJMSF047B17+ ATTCTGTGCTGATAATGCATTCACTTGACAATGTTGATG
rJMSF038H07+ ATTCTGTGCTGATAATGCATTCACTTGACAATGTTGATG
rJMSF012J20+ ATTCTGTGCTGATAATGCATTCACTTGACAATGTTGATGTAGAGCTTCACTTTGGTGCCC
                      ____________________________________________________________
consensus ATTCTGTGCTGATAATGCATTCACTTGACAATGTTGATGTAGAGCTTCACTTTGGTGCCC