Previous Contig 011697:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027A23Sequence569011697 (30)582011697 (30)
JMFF041N21Sequence568011697 (30)568011697 (30)
JMFN010I22Sequence525011697 (30)
JMFN013O16Sequence586011697 (30)
JMFN017C02Sequence537011697 (30)
JMFN020C11Sequence549011697 (30)
JMFN025D11Sequence398011697 (30)
JMFN028I22Sequence532011697 (30)
JMFN030F16Sequence546011697 (30)
JMFN034P05Sequence565011697 (30)
JMFN036H17Sequence605011697 (30)
JMFN039O05Sequence532011697 (30)
JMFN042E02Sequence524011697 (30)
JMFN042K09Sequence602011697 (30)
JMFN043P23Sequence640011697 (30)
JMFN044F01Sequence550011697 (30)
JMFN044P18Sequence557011697 (30)
JMFN046J10Sequence541011697 (30)
JMFN046O14Sequence546011697 (30)
JMFS169H05Sequence560011697 (30)
JMSF009O20Sequence266011697 (30)520011697 (30)
JMSF009P19Sequence520011697 (30)
JMSF012I16Sequence512005324 (2)744011697 (30)
JMSF020E12Sequence545011697 (30)484011697 (30)
JMSF022E12Sequence195011697 (30)
JMSF027B13Sequence768005324 (2)753011697 (30)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044P18+ AAATACAAGTAAAAA
JMFN039O05+ AAATACAAGTAAAAA
JMFN013O16+ AAAATTATTAGAGCTTATCAGATTCTTATAAAATACAAGTAAAAA
JMFS169H05+ TACAAGTAAAAA
rJMFF041N21- ACAAGTAAAAA
JMFF041N21+ ACAAGTAAAAA
JMFN034P05+ AAGTAAAAA
JMFN020C11+ ACAAGTAAAAA
JMFN044F01+ ACAAGTAAAAA
JMFN030F16+ ACAAGTAAAAA
JMFN046O14+ AAAAA
JMFN017C02+ ACAAGTAAAAA
JMFN028I22+ ACAAGTAAAAA
JMFN010I22+ ACAAGTAAAAA
JMFN042E02+ ACAAGTAAAAA
JMFF027A23+ TACAAGTAAAAA
JMFN042K09+ CAAGTAAAAA
JMFN043P23+ AAAAA
                      ____________________________________________________________
consensus AAAATTATTAGAGCTTATCAGATTCTTATAAAATACAAGTAAAAA
 
. : . : . : . : . : . :
JMFN044P18+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN039O05+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN013O16+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFS169H05+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
rJMFF041N21- GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFF041N21+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN034P05+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN020C11+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN044F01+ GATATTTATNTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN030F16+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN046J10+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN046O14+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMSF020E12+ TTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATTGACATGAAATGA
JMFN017C02+ GATATTTATTTAGTCAATACATAATGGTTCCGTCCACGAATCACGATCGACATGAAATGA
JMFN028I22+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN010I22+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN042E02+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
rJMFF027A23- A
JMFF027A23+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
rJMSF009P19- GAATCACGATCGACATGAAATGA
rJMSF009O20- CGAATCACGATCGACATGAAATGA
JMFN042K09+ GATATTTATNTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
JMFN043P23+ GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
rJMSF027B13- AATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
rJMSF012I16- ACGAATCACGATCGACATGAAATGA
                      ____________________________________________________________
consensus GATATTTATTTAGTCAATACATAATGGTTGCGTCCACGAATCACGATCGACATGAAATGA
 
. : . : . : . : . : . :
JMFN044P18+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN039O05+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN013O16+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFS169H05+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
rJMFF041N21- AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFF041N21+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN034P05+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN020C11+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN044F01+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN030F16+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN046J10+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN046O14+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMSF020E12+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN017C02+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN028I22+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN010I22+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN042E02+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
rJMFF027A23- AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
rJMSF020E12- CGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN025D11+ AA
JMFF027A23+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
rJMSF009P19- AACGTAGTTTCATACTATCTAGTTACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
rJMSF009O20- AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN042K09+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN043P23+ AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
JMFN036H17+ TTCGACCGAAATCAA
rJMSF027B13- AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
rJMSF012I16- AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
                      ____________________________________________________________
consensus AACGTAGTTTCATACTATCTAG-TACAGTGGTAGAACCCTAGAACTTCGACCGAAATCAA
 
. : . : . : . : . : . :
JMFN044P18+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN039O05+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN013O16+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFS169H05+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
rJMFF041N21- AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFF041N21+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN034P05+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN020C11+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN044F01+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN030F16+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN046J10+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN046O14+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMSF020E12+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN017C02+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN028I22+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN010I22+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN042E02+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
rJMFF027A23- AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
rJMSF020E12- AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN025D11+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFF027A23+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
rJMSF009P19- AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
rJMSF009O20- AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN042K09+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN043P23+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
JMFN036H17+ AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
rJMSF027B13- AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
rJMSF012I16- AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
                      ____________________________________________________________
consensus AAGATCCAGATACTATAATTTCATACGAAACACAGACAGACAGACACAGATGTATATGTT
 
. : . : . : . : . : . :
JMFN044P18+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN039O05+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN013O16+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFS169H05+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
rJMFF041N21- CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFF041N21+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN034P05+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN020C11+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN044F01+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN030F16+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN046J10+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN046O14+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMSF020E12+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN017C02+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN028I22+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN010I22+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN042E02+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
rJMFF027A23- CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
rJMSF020E12- CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN025D11+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCGCGACACATATTATT
rJMSF022E12- AACTGANCCTGCTNGCTTACTTCATCACGATTCACGACACATATTATT
JMFF027A23+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
rJMSF009P19- CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
rJMSF009O20- CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN042K09+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN043P23+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
JMFN036H17+ CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
rJMSF027B13- CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
rJMSF012I16- CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
                      ____________________________________________________________
consensus CCATCGCCGTGGAACTGAACCTGCTAGCTTACTTCATCACGATTCACGACACATATTATT
 
. : . : . : . : . : . :
JMFN044P18+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN039O05+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN013O16+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFS169H05+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMFF041N21- CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFF041N21+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN034P05+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN020C11+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN044F01+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN030F16+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN046J10+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN046O14+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMSF020E12+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN017C02+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN028I22+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN010I22+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN042E02+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMFF027A23- CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMSF020E12- CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN025D11+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMSF022E12- CNNGCTGGANATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCANATCAGACAT
JMFF027A23+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMSF009P19- CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMSF009O20- CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMSF009O20+ ATCAGAGAT
JMFN042K09+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN043P23+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
JMFN036H17+ CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMSF027B13- CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
rJMSF012I16- CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
                      ____________________________________________________________
consensus CAAGCTGGAAATAGTGAAATACTCGCAACCGTGGACGCACCAGATCTGCAGATCAGAGAT
 
. : . : . : . : . : . :
JMFN044P18+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN039O05+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN013O16+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFS169H05+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMFF041N21- GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFF041N21+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN034P05+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN020C11+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN044F01+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN030F16+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN046J10+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN046O14+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMSF020E12+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN017C02+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN028I22+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN010I22+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN042E02+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMFF027A23- GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMSF020E12- GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN025D11+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMSF022E12- GACTGGANTGTATCTAGTGNCGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFF027A23+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMSF009P19- GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMSF009O20- GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMSF009O20+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN042K09+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN043P23+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
JMFN036H17+ GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMSF027B13- GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
rJMSF012I16- GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
                      ____________________________________________________________
consensus GACTGGAGTGTATCTAGTGGTGATGGTGGTGGTGATGCGGTGGATGCGGATGGTGAACCG
 
. : . : . : . : . : . :
JMFN044P18+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN039O05+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN013O16+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFS169H05+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
rJMFF041N21- GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFF041N21+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN034P05+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN020C11+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN044F01+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN030F16+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN046J10+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN046O14+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMSF020E12+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN017C02+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN028I22+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN010I22+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN042E02+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
rJMFF027A23- GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
rJMSF020E12- GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN025D11+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCGCGTGAACTA
rJMSF022E12- GCGGCGGNNGATGATGGTGCACTA
JMFF027A23+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
rJMSF009P19- GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
rJMSF009O20- GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMSF009O20+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN042K09+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN043P23+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
JMFN036H17+ GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
rJMSF027B13- GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
rJMSF012I16- GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGGTCGTGCACGTGAACTA
                      ____________________________________________________________
consensus GCGGCGGGGGATGATGGTGCACTACTGGCGGAGGCGGCGGCGGATCGTGCACGTGAACTA
 
. : . : . : . : . : . :
JMFN044P18+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN039O05+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN013O16+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFS169H05+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
rJMFF041N21- CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFF041N21+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN034P05+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN020C11+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN044F01+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN030F16+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN046J10+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN046O14+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMSF020E12+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN017C02+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN028I22+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN010I22+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN042E02+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
rJMFF027A23- CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
rJMSF020E12- CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN025D11+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFF027A23+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
rJMSF009P19- CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
rJMSF009O20- CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMSF009O20+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN042K09+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN043P23+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
JMFN036H17+ CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
rJMSF027B13- CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
rJMSF012I16- CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
                      ____________________________________________________________
consensus CCGGCGGAGGTGGATGGTGGTGCACTACCGGCGGCGGCGGGGGATGGTGCACGACGTGAA
 
. : . : . : . : . : . :
JMFN044P18+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN039O05+ CTACCGGCGGCGGCGGAGGTGAGTGTC
JMFN013O16+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFS169H05+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
rJMFF041N21- CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFF041N21+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN034P05+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN020C11+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATT
JMFN044F01+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN030F16+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCC
JMFN046J10+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN046O14+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGC
JMSF020E12+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN017C02+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGG
JMFN028I22+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGT
JMFN010I22+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGG
JMFN042E02+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGG
rJMFF027A23- CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
rJMSF020E12- CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN025D11+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGT
JMFF027A23+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
rJMSF009P19- CTACCG--GGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
rJMSF009O20- CTACCG--GGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMSF009O20+ CTACCG--GGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN042K09+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN043P23+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
JMFN036H17+ CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
rJMSF027B13- CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
rJMSF012I16- CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
                      ____________________________________________________________
consensus CTACCGGCGGCGGCGGAGGTGAGTGTCTATGCGGGTGGTGGTGTGGGCGGTGTGCCATTT
 
. : . : . : . : . : . :
JMFN044P18+ TG
JMFN013O16+ TG
JMFS169H05+ TGTCTTG
rJMFF041N21- TGTCTTGGGATTTTTTCT
JMFF041N21+ TGTCTTGGGATTTTTTCT
JMFN034P05+ TGTCTTGGGATTTTTTC
JMFN046J10+ TG
JMSF020E12+ TGTCTT
rJMFF027A23- TGTCTTGGGATTTTTTCT
rJMSF020E12- TGTCTT
JMFF027A23+ TGTCTTGGGATTTTTTCT
rJMSF009P19- TGTCTTGGGATTTTTTCT
rJMSF009O20- TGTCTTGGGATTTTTTCT
JMSF009O20+ TGTCTTGGGATTTTTTCT
JMFN042K09+ TGTCTTGGGATTTTTTCTGGGCAAGGACAAAAGCGTTGAAGAGGATATATAGG
JMFN043P23+ TGTCTTGGGATTTTTTCTGGGCAAGGACAAAAGCGTTGAAGAGGATATATAGGGATAAGA
JMFN036H17+ TGTCTTGGGATTTTTTCTGGGCAAGGACAAAAGCGTTGAAGAGGATATATAGGGATAAGA
rJMSF027B13- TGTCTTGGGATTTTTTCTGGGCAAGGACAAAAGCGTTGAAGAGGATATATAGGGATAAGA
rJMSF012I16- TGTCTTGGGATTTTTTCTGGGCAAGGACAAAAGCGTTGAAGAGGATATATAGGGATAAGA
                      ____________________________________________________________
consensus TGTCTTGGGATTTTTTCTGGGCAAGGACAAAAGCGTTGAAGAGGATATATAGGGATAAGA
 
. : . : . : . : . : . :
JMFN043P23+ TTGAACTTAAGAACTAAGTAAAGGGATAACGACGTG
JMFN036H17+ TTGAACTTAAGAACTAAGTAAAGGGATAACGACGTGCGGTAGCGTGTAATGTATTCGCGG
rJMSF027B13- TTGAACTTAAGAACTAAGTAAAGGGATAACGACGTGCGGTAGCGTGTAATGTATTCGCGG
rJMSF012I16- TTGAACTTAAGAACTAAGTAAAGGGATAACGACGTGCGGTAGCGTGTAATGTATTCGCGG
                      ____________________________________________________________
consensus TTGAACTTAAGAACTAAGTAAAGGGATAACGACGTGCGGTAGCGTGTAATGTATTCGCGG
 
. : . : . : . : . : . :
JMFN036H17+ AGATTGGAGAATGGAGATGTTAAGGTTGCGGGCTAAACACGTCAACGCGG
rJMSF027B13- AGATTGGAGAATGGAGATGTTAAGGTTGCGGGCTAAACACGTCAACGCGGTCGAGGCAAG
rJMSF012I16- AGATTGGAGAATGGAGATGTTAAGGTTGCGGGCTAAACACGTCAACGCGGTCGAGGCNAG
                      ____________________________________________________________
consensus AGATTGGAGAATGGAGATGTTAAGGTTGCGGGCTAAACACGTCAACGCGGTCGAGGCAAG
 
. : . : . : . : . : . :
rJMSF027B13- CATGCCTGGAACTGGAAGTCTCCACCATAATAATTAAATACAAATTTCCAATGGTG
rJMSF012I16- CATGCCTGGAACTGGAAGTCTCCACCATAATAATTAAATACAAATTTCCAATGGTGGTAG
                      ____________________________________________________________
consensus CATGCCTGGAACTGGAAGTCTCCACCATAATAATTAAATACAAATTTCCAATGGTGGTAG