Previous Contig 011680:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN044L09Sequence618011680 (2)gb:AY054189_15630115e-39Arabidopsis thaliana AT3g20870/MOE17_16 mRNA, complete cds.>gb:BT006342_1639229
JMSF012F11Sequence495018769550011680 (2)gb:AY054189_15630113e-43Arabidopsis thaliana AT3g20870/MOE17_16 mRNA, complete cds.>gb:BT006342_1639229

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044L09- TTTGTCTTACACTTTTTGGCCAATGAATGACTTGATGAAATGTTCTA
                      ____________________________________________________________
consensus TTTGTCTTACACTTTTTGGCCAATGAATGACTTGATGAAATGTTCTA
 
. : . : . : . : . : . :
JMFN044L09- TTTATGCTTATACCACTCCATGCAAGTAGGCATCATGTGTAGTCTGTCTAATCAATGCTT
                      ____________________________________________________________
consensus TTTATGCTTATACCACTCCATGCAAGTAGGCATCATGTGTAGTCTGTCTAATCAATGCTT
 
. : . : . : . : . : . :
JMFN044L09- TGAAATCTTAGGAAGTAAGAGAGGAACCTTCTCTTCTAAATTTCATATTCTTGCGTGGCG
                      ____________________________________________________________
consensus TGAAATCTTAGGAAGTAAGAGAGGAACCTTCTCTTCTAAATTTCATATTCTTGCGTGGCG
 
. : . : . : . : . : . :
JMFN044L09- TTTGAGACTTCTATGATAAATCATCAAAATCTATTACTGACTGAGGTTGAAAATATGTGT
                      ____________________________________________________________
consensus TTTGAGACTTCTATGATAAATCATCAAAATCTATTACTGACTGAGGTTGAAAATATGTGT
 
. : . : . : . : . : . :
JMFN044L09- ACGTTTCTTGATTGAAAGAAAAGGAGTAAATGGCTTTTGAGATCTTTTTTTCTTTCTTTT
                      ____________________________________________________________
consensus ACGTTTCTTGATTGAAAGAAAAGGAGTAAATGGCTTTTGAGATCTTTTTTTCTTTCTTTT
 
. : . : . : . : . : . :
JMFN044L09- TTGCTGTAACAGGAATAAGCTTGCACAACTTTCCAGAGGGAATGGCTGTGTTCCTTGGAT
                      ____________________________________________________________
consensus TTGCTGTAACAGGAATAAGCTTGCACAACTTTCCAGAGGGAATGGCTGTGTTCCTTGGAT
 
. : . : . : . : . : . :
JMFN044L09- CAATCAAGGGTCTTCGAGTTGGTATCAATTTGGCCCTTGCCATTTCGTTGCACAACATCC
rJMSF012F11+ CACAACATCC
                      ____________________________________________________________
consensus CAATCAAGGGTCTTCGAGTTGGTATCAATTTGGCCCTTGCCATTTCGTTGCACAACATCC
 
. : . : . : . : . : . :
JMFN044L09- CAGAGGGTGTTGCGGTTGCACTTCCAGTTTATTTTGCAACTCAGAGCAAATGGCAGGCTT
rJMSF012F11+ CAGAGGGTGTTGCGGTTGCACTTCCAGTTTATTTTGCAACTCAGAGCAAATGGCAGGCTT
                      ____________________________________________________________
consensus CAGAGGGTGTTGCGGTTGCACTTCCAGTTTATTTTGCAACTCAGAGCAAATGGCAGGCTT
 
. : . : . : . : . : . :
JMFN044L09- TCAAGATTGCTACACTTTCCGGCTTGGCAGAGCCCTTGGGTGTGATTATTGTAGCCTATC
rJMSF012F11+ TCAAGATTGCTACACTTTCCGGCTTGGCAGAGCCNTTGGGTGTGATTATTGTAGCCTATC
                      ____________________________________________________________
consensus TCAAGATTGCTACACTTTCCGGCTTGGCAGAGCCCTTGGGTGTGATTATTGTAGCCTATC
 
. : . : . : . : . : . :
JMFN044L09- TATTTCCAAGCAGCTTAAGTCCTGAAGTTCTGGAGGGCCTCCTTGGATCGGTTGGTGGGG
rJMSF012F11+ TATTTCCAAGCAGCTTAAGTCCTGAAGTTCTGGAGGGCCTCCTNGGATCGGTTGGTGGGG
                      ____________________________________________________________
consensus TATTTCCAAGCAGCTTAAGTCCTGAAGTTCTGGAGGGCCTCCTTGGATCGGTTGGTGGGG
 
. : . : . : . : . : . :
JMFN044L09- TGATGGCTTTCCT-ACCCTGCACGAA
rJMSF012F11+ TGATGGCTTTCCTAACCCTGCACGAAATGCTGCCACTGGCATTTGACTATGCGGGCCAAA
                      ____________________________________________________________
consensus TGATGGCTTTCCTAACCCTGCACGAAATGCTGCCACTGGCATTTGACTATGCGGGCCAAA
 
. : . : . : . : . : . :
rJMSF012F11+ AGAACGCAGTCAAGGCTGTGTTTCTTGGAATGGCTTTCATGTCTGCTAGCCTGTATTTCN
                      ____________________________________________________________
consensus AGAACGCAGTCAAGGCTGTGTTTCTTGGAATGGCTTTCATGTCTGCTAGCCTGTATTTCN
 
. : . : . : . : . : . :
rJMSF012F11+ TACAGACCAGCTTACCGGAGGATATGAGCTTGTAGTTTNTGATCATACGACGCCAACCTG
                      ____________________________________________________________
consensus TACAGACCAGCTTACCGGAGGATATGAGCTTGTAGTTTNTGATCATACGACGCCAACCTG
 
. : . : . : . : . : . :
rJMSF012F11+ AGAGTCCAATAGTTCTTCTAACCATGTTTGGAAACCCCACCCCCACCCCCACTCTTCCTC
                      ____________________________________________________________
consensus AGAGTCCAATAGTTCTTCTAACCATGTTTGGAAACCCCACCCCCACCCCCACTCTTCCTC
 
. : . : . : . : . : . :
rJMSF012F11+ CTTCTCCATGGATGAAGGGTCACAAGAAGNGAATAGTAGAAGNCAGGAAAACGANTATTT
                      ____________________________________________________________
consensus CTTCTCCATGGATGAAGGGTCACAAGAAGNGAATAGTAGAAGNCAGGAAAACGANTATTT
 
. : . : . : . : . : . :
rJMSF012F11+ GTAAAATGAGGGATATTGCAAATTCACTGTATATGTGACNGACTGACTANATACTCATCA
                      ____________________________________________________________
consensus GTAAAATGAGGGATATTGCAAATTCACTGTATATGTGACNGACTGACTANATACTCATCA