Previous Contig 011678:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007J02Sequence392011678 (4)sp|Q9XFH3|MAD2_MAIZE6e-40Mitotic spindle checkpoint protein MAD2.>gb:AF143681_1771821 Zea mays cell cycle736011678 (4)sp|Q9LU93|MAD2_ARATHe-100Mitotic spindle checkpoint protein MAD2.>gb:AB023041_1515452 Arabidopsis thalian
JMSF012E21Sequence238011678 (4)sp|Q9XFH3|MAD2_MAIZE2e-14Mitotic spindle checkpoint protein MAD2.>gb:AF143681_1771821 Zea mays cell cycle733011678 (4)sp|Q9LU93|MAD2_ARATH1e-94Mitotic spindle checkpoint protein MAD2.>gb:AB023041_1515452 Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012E21- GGAACTCATCAAAACGCAAAACCTAAATTTTAGATCATTCGA
JMSF007J02- GGGGAACTCATCAAAACGCAAAACCTAAATTTTAGATCATTCGA
                      ____________________________________________________________
consensus GGGGAACTCATCAAAACGCAAAACCTAAATTTTAGATCATTCGA
 
. : . : . : . : . : . :
JMSF012E21- AACCACCAGCCCCTACTTCTCTTGAGTTGAATTTAGAATCTCACATTCTAAGCATTCAGA
JMSF007J02- AACCACCAGCCCCTACTTCTCTTGAGTTGAATTTAGAATCTCACATTCTAAGCATTCAGA
rJMSF007J02+ ATTCAGA
                      ____________________________________________________________
consensus AACCACCAGCCCCTACTTCTCTTGAGTTGAATTTAGAATCTCACATTCTAAGCATTCAGA
 
. : . : . : . : . : . :
JMSF012E21- AACATGGCTTCAAGAACAGCCTCCAAAGATATAATCACTCTTCGGGGATCAGCCGCTATT
JMSF007J02- AACATGGCTTCAAGAACAGCCTCCAAAGATATAATCACTCTTCGGGGATCAGCCGCTATT
rJMSF007J02+ AACATGGCTTCAAGAACAGCCTCCAAAGATATAATCACTCTTCGGGGATCAGCCGCTATT
rJMSF012E21+ ATCAGCCGCTATT
                      ____________________________________________________________
consensus AACATGGCTTCAAGAACAGCCTCCAAAGATATAATCACTCTTCGGGGATCAGCCGCTATT
 
. : . : . : . : . : . :
JMSF012E21- GTCAGTGAATTCTTCGGTTATGCTGCAAATAGTATTTTATACAACCGCGGTTTGTATCCT
JMSF007J02- GTCAGTGAATTCTTCGGTTATGCTGCAAATAGTATTTTATACAACCGCGGTTTGTATCCT
rJMSF007J02+ GTCAGTGAATTCTTCGGTTATGCTGCAAATAGTATTTTATACAACCGCGGTTTGTATCCT
rJMSF012E21+ GTCAGTGAATTCTTCGGTTATGCTGCAAATAGTATTTTATACAACCGCGGTTTGTATCCT
                      ____________________________________________________________
consensus GTCAGTGAATTCTTCGGTTATGCTGCAAATAGTATTTTATACAACCGCGGTTTGTATCCT
 
. : . : . : . : . : . :
JMSF012E21- GAANAGAGTTTCGCGA
JMSF007J02- GAAGAGAGTTTCGCGAAGGTGAAGAAGTATGGGCTTCCGATGTTGCTCACTCAAGATGAA
rJMSF007J02+ GAAGAGAGTTTCGCGAAGGTGAAGAAGTATGGGCTTCCGATGTTGCTCACTCAAGATGAA
rJMSF012E21+ GAAGAGAGTTTCGCGAAGGTGAAGAAGTATGGGCTTCCGATGTTGCTCACTCAAGATGAA
                      ____________________________________________________________
consensus GAAGAGAGTTTCGCGAAGGTGAAGAAGTATGGGCTTCCGATGTTGCTCACTCAAGATGAA
 
. : . : . : . : . : . :
JMSF007J02- GGTGTCAAAACCTTCATTTCCAACTTAACAGCCCAAATTTCTGAGTGGCTGGAGGCCGGG
rJMSF007J02+ GGTGTCAAAACCTTCATTTCCAACTTAACAGCCCAAATTTCTGAGTGGCTGGAGGCCGGG
rJMSF012E21+ GGTGTCAAAACCTTCATTTCCAACTTAACAGCCCAAATTTCTGAGTGGCTGGAGGCCGGG
                      ____________________________________________________________
consensus GGTGTCAAAACCTTCATTTCCAACTTAACAGCCCAAATTTCTGAGTGGCTGGAGGCCGGG
 
. : . : . : . : . : . :
JMSF007J02- AAACTACAGAGGGTTGTGCTTGTGATCATGAGTAAGGCCAGTGGTGAG
rJMSF007J02+ AAACTACAGAGGGTTGTGCTTGTGATCATGAGTAAGGCCAGTGGTGAGGTGTTAGAGAGG
rJMSF012E21+ AAACTACAGAGGGTTGTGCTTGTGATCATGAGTAAGGCCAGTGGTGAGGTGTTAGAGAGG
                      ____________________________________________________________
consensus AAACTACAGAGGGTTGTGCTTGTGATCATGAGTAAGGCCAGTGGTGAGGTGTTAGAGAGG
 
. : . : . : . : . : . :
rJMSF007J02+ TGGAATTTCAGTATTGAGACAGACAGTGAGGTTGTTGAGAAAGGTGTTTCAAGGGAGAAG
rJMSF012E21+ TGGAATTTCAGTATTGAGACAGACAGTGAGGTTGTTGAGAAAGGTGTTTCAAGGGAGAAG
                      ____________________________________________________________
consensus TGGAATTTCAGTATTGAGACAGACAGTGAGGTTGTTGAGAAAGGTGTTTCAAGGGAGAAG
 
. : . : . : . : . : . :
rJMSF007J02+ AGTGATAAAGAAATAATGCGCGAAATTCAAGCGATTATGAGACAAATAGCTTCCAGCATT
rJMSF012E21+ AGTGATAAAGAAATAATGCGCGAAATTCAAGCGATTATGAGACAAATAGCTTCCAGCATT
                      ____________________________________________________________
consensus AGTGATAAAGAAATAATGCGCGAAATTCAAGCGATTATGAGACAAATAGCTTCCAGCATT
 
. : . : . : . : . : . :
rJMSF007J02+ ACATATCTCCCATGCCTTGATGAAGCATGCGTGTTCGATGTGTTAGCCTACACTGATACA
rJMSF012E21+ ACATATCTCCCATGCCTTGATGAAGCATGCGTGTTCGATGTGTTAGCCTACACTGATACA
                      ____________________________________________________________
consensus ACATATCTCCCATGCCTTGATGAAGCATGCGTGTTCGATGTGTTAGCCTACACTGATACA
 
. : . : . : . : . : . :
rJMSF007J02+ GATGTTGCAGTCCCGTTCACCTGGATCGAAAGTGACCCTAAACTGATAGCAAATCCACAA
rJMSF012E21+ GATGTTGCAGTCCCGTTCACCTGGATCGAAAGTGACCCTAAACTGATAGCAAATCCACAA
                      ____________________________________________________________
consensus GATGTTGCAGTCCCGTTCACCTGGATCGAAAGTGACCCTAAACTGATAGCAAATCCACAA
 
. : . : . : . : . : . :
rJMSF007J02+ ATGGTCAAATTGCATTCCTTTGATACCAAGATACACAAGGTTGACACTCTGGTTTCCTAC
rJMSF012E21+ ATGGTCAAATTGCATTCCTTTGATACCAAGATACACAAGGTTGACACTCTGGTTTCCTAC
                      ____________________________________________________________
consensus ATGGTCAAATTGCATTCCTTTGATACCAAGATACACAAGGTTGACACTCTGGTTTCCTAC
 
. : . : . : . : . : . :
rJMSF007J02+ AAGAATGATGATGAGTGGGATGAGGCATGAATGAATGTTAGTTTTAGGCAGTTGTCTTTA
rJMSF012E21+ AAGAATGATGATGAGTGGGATGAGGCATGAATGAATGTTAGTTTTAGGCAGTTGTCTTTA
                      ____________________________________________________________
consensus AAGAATGATGATGAGTGGGATGAGGCATGAATGAATGTTAGTTTTAGGCAGTTGTCTTTA
 
. : . : . : . : . : . :
rJMSF007J02+ TTGTCCAATGTGTTTTAAGTTTGTGAATCGTCAATTCACATTTAGTATTATGTAAGTGAG
rJMSF012E21+ TTGTCCAATGTGTTTTAAGTTTGTGAATCGTCAATTCACATTTAGTATTATGTAAGTGAG
                      ____________________________________________________________
consensus TTGTCCAATGTGTTTTAAGTTTGTGAATCGTCAATTCACATTTAGTATTATGTAAGTGAG
 
. : . : . : . : . : . :
rJMSF007J02+ AGGAAAGTC
rJMSF012E21+ AGGAAAGTCCTAAACTCTTTATAACCAAGTATTACCATGATTTATGTTGTTGCAGCTATT
                      ____________________________________________________________
consensus AGGAAAGTCCTAAACTCTTTATAACCAAGTATTACCATGATTTATGTTGTTGCAGCTATT