Previous Contig 011673:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007B06Sequence542001436 (120)gb:NTOEE2AG_16916566e-53N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.749011673 (5)gb:CAR276267_16452092e-64Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.
JMFF017H22Sequence609000900 (4)gb:CAR276267_16452094e-46Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.425011673 (5)gb:CAR276267_16452092e-33Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.
JMFF040G14Sequence544000900 (4)gb:CAR276267_16452097e-54Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.701011673 (5)gb:CAR276267_16452098e-64Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.
JMSF012C12Sequence492000900 (4)gb:CAR276267_16452099e-28Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.787011673 (5)gb:CAR276267_16452093e-64Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.
JMSF017C05Sequence418000900 (4)gb:CAR276267_16452098e-32Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.752011673 (5)gb:CAR276267_16452099e-78Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017C05+ TAGTGGGGATTATTCTACTGTTCCTTCCATCCCTGGATA
                      ____________________________________________________________
consensus TAGTGGGGATTATTCTACTGTTCCTTCCATCCCTGGATA
 
. : . : . : . : . : . :
rJMSF017C05+ TGGTTGGATTAAACCCTCGCAACAAGTTTGGTTTCAGAACACTTCTCATAATCTTAAGAG
rJMFF040G14+ TAAGAG
rJMFF007B06+ TAAGAG
rJMSF012C12+ TAAGAG
                      ____________________________________________________________
consensus TGGTTGGATTAAACCCTCGCAACAAGTTTGGTTTCAGAACACTTCTCATAATCTTAAGAG
 
. : . : . : . : . : . :
rJMSF017C05+ AACTTACATGAGCAGTCCTGCAGCTCAGAAGGTCCCAGCTCCAAGCCTTGTATACTTCCA
rJMFF040G14+ AACTTACATGAGCAGTCNTGCAGCTCAGAAGGTCCCAGCTCCAAGCCTTGTATACTTCCA
rJMFF007B06+ AACTTACATGAGCAGTCCTGCAGCTCAGAAGGTCCCAGCTCCAAGCCTTGTATACTTCCA
rJMSF012C12+ AACTTACATGAGCAGTCCTGCAGCTCAGAAGGTCCCAGCTCCAAGCCTTGTATACTTCCA
                      ____________________________________________________________
consensus AACTTACATGAGCAGTCCTGCAGCTCAGAAGGTCCCAGCTCCAAGCCTTGTATACTTCCA
 
. : . : . : . : . : . :
rJMSF017C05+ TATTCCCTTGCCCGAATATGCAAGCTTCGACTCCTCAAACTTCACAGGTGTTAGACAGGA
rJMFF040G14+ TATTCCCTTGCCCGAATATGCAAGCTTCGACTCCTCAAACTTCACAGGTGTTAGACAGGA
rJMFF007B06+ TATTCCCTTGCCCGAATATGCAAGCTTCGACTCCTCAAACTTCACAGGTGTTAGACAGGA
rJMSF012C12+ TATTCCCTTGCCCGAATATGCAAGCTTCGACTCCTCAAACTTCACAGGTGTTAGACAGGA
                      ____________________________________________________________
consensus TATTCCCTTGCCCGAATATGCAAGCTTCGACTCCTCAAACTTCACAGGTGTTAGACAGGA
 
. : . : . : . : . : . :
rJMSF017C05+ AGGCATTAGTTCTGCATCAATAAATTCTGGTTTCTTCACAACAATGGTGGAAACAGGAGA
rJMFF040G14+ AGGCATTAGTTCTGCATCAATAAATTCTGGTTTCTTCACAACAATGGTGGAAACAGGAGA
rJMFF007B06+ AGGCATTAGTTCTGCATCAATAAATTCTGGTTTCTTCACAACAATGGTGGAAACAGGAGA
rJMSF012C12+ AGGCATTAGTTCTGCATCAATAAATTCTGGTTTCTTCACAACAATGGTGGAAACAGGAGA
                      ____________________________________________________________
consensus AGGCATTAGTTCTGCATCAATAAATTCTGGTTTCTTCACAACAATGGTGGAAACAGGAGA
 
. : . : . : . : . : . :
rJMSF017C05+ CGTGAAGGGCGTTTTCACTGGGCATGATCACAAGAATGATTTTTGTGGGGAGTTGATGGG
rJMFF040G14+ CGTGAAGGGCGTTTTCACTGGGCATGATCACAAGAATGATTTTTGTGGGGAGTTGATGGG
rJMFF017H22+ GGCATGATCACAAGAATGATTTTTNTGGGGAGTTGATGGG
rJMFF007B06+ CGTGAAGGGCGTTTTCACTGGGCATGATCACAAGAATGATTTTTGTGGGGAGTTGATGGG
rJMSF012C12+ CGTGAAGGGCGTTTTCACTGGGCATGATCACAAGAATGATTTTTGTGGGGAGTTGATGGG
                      ____________________________________________________________
consensus CGTGAAGGGCGTTTTCACTGGGCATGATCACAAGAATGATTTTTGTGGGGAGTTGATGGG
 
. : . : . : . : . : . :
rJMSF017C05+ CATAAATCTGTGTTATGCTGGAGGCTTCGGTTACCATGCTTATGGGAAAGCTGGATGGGC
rJMFF040G14+ CATAAATCTGTGTTATGCTGGAGGCTTCGGTTACCATGCTTATGGGAAAGCTGGATGGGC
rJMFF017H22+ CATAAATCTGTGTTATGCTGGAGGCTTCGGTTACCATGCTTATGGGAAAGCTGGATGGGC
rJMFF007B06+ CATAAATCTGTGTTATGCTGGAGGCTTCGGTTACCATGCTTATGGGAAAGCTGGATGGGC
rJMSF012C12+ CATAAATCTGTGTTATGCTGGAGGCTTCGGTTACCATGCTTATGGGAAAGCTGGATGGGC
                      ____________________________________________________________
consensus CATAAATCTGTGTTATGCTGGAGGCTTCGGTTACCATGCTTATGGGAAAGCTGGATGGGC
 
. : . : . : . : . : . :
rJMSF017C05+ AAGGAGGGCAAGGATGGTGGTAGCAACTTTGGAGAAGACCGAGAAAGGAATATGGGGTGA
rJMFF040G14+ AAGGAGGGCAAGGATGGTGGTAGCAACTTTGGAGAAGACCGAGAAAGGAATATGGGGTGA
rJMFF017H22+ AAGGAGGGCAAGGATGGTGGTAGCAACTTTGGAGAAGNCCGAGAAAGGAATATGGGGTGA
rJMFF007B06+ AAGGAGGGCAAGGATGGTGGTAGCAACTTTGGAGAAGACCGAGAAAGGAATATGGGGTGA
rJMSF012C12+ AAGGAGGGCAAGGATGGTGGTAGCAACTTTGGAGAAGACCGAGAAAGGAATATGGGGTGA
                      ____________________________________________________________
consensus AAGGAGGGCAAGGATGGTGGTAGCAACTTTGGAGAAGACCGAGAAAGGAATATGGGGTGA
 
. : . : . : . : . : . :
rJMSF017C05+ TGTCAAATCTATCAGGACCTGGAAGCGACTCGATGATGAACACCTTACTACAATTGACCG
rJMFF040G14+ TGTCAAATCTATCAGGACCTGGAAGCGACTCGATGATGAACACCTTACTACAATTGACCG
rJMFF017H22+ TGTCAAATCTATCAGGACCTGGAAGCGACTCGATGATGAACACCTTACTACAATTGACCG
rJMFF007B06+ TGTCAAATCTATCAGGACCTGGAAGCGACTCGATGATGAACACCTTACTACAATTGACCG
rJMSF012C12+ TGTCAAATCTATCAGGACCTGGAAGCGACTCGATGATGAACACCTTACTACAATTGACCG
                      ____________________________________________________________
consensus TGTCAAATCTATCAGGACCTGGAAGCGACTCGATGATGAACACCTTACTACAATTGACCG
 
. : . : . : . : . : . :
rJMSF017C05+ TGAAGTGCTTTGGAGCAAGAACTCTGGTGGCAGCCGCAGAAAGAAGAAGATTAGCCACCC
rJMFF040G14+ TGAAGTGCTTTGGAGCAAGAACTCTGGTGGCAGCCGCAGAAAGAAGAAGATTAGCCACCC
rJMFF017H22+ TGAAGTGCTTTGGAGCAAGAACTCTGGT----GCCGCAGAAAGAAGAAGATTAGCCACCC
rJMFF007B06+ TGAAGTGCTTTGGAGCAAGAACTCTGGTGGCAGCCGCAGAAAGAAGAAGATTAGCCACCC
rJMSF012C12+ TGAAGTGCTTTGGAGCAAGAACTCTGGTGGCAGCCGCAGAAAGAAGAAGATTAGCCACCC
                      ____________________________________________________________
consensus TGAAGTGCTTTGGAGCAAGAACTCTGGTGGCAGCCGCAGAAAGAAGAAGATTAGCCACCC
 
. : . : . : . : . : . :
rJMSF017C05+ GCGCAGAAATTTCTGATTCTATTTGATCTAAATTAAAGCAGACTATTCCCGGCTGTCATA
rJMFF040G14+ GCGCAGAAATTTCTGATTCTATTTGATCTAAATTAAAGCAGACTATTCCCGGCTGTCATA
rJMFF017H22+ GCGCAGAAATTTCTGATTCTATTTGATNTAAATTAAAGCAGACTATTCCCGGCTGTCATA
rJMFF007B06+ GCGCAGAAATTTCTGATTCTATTTGATCTAAATTAAAGCAGACTATTCCCGGCTGTCATA
rJMSF012C12+ GCGCAGAAATTTCTGATTCTATTTGATCTAAATTAAAGCAGACTATTCCCGGCTGTCATA
                      ____________________________________________________________
consensus GCGCAGAAATTTCTGATTCTATTTGATCTAAATTAAAGCAGACTATTCCCGGCTGTCATA
 
. : . : . : . : . : . :
rJMSF017C05+ CATAGTATTGTGCAATTATATGAATGATACGGAGTAGAATGTTAACACAGCAATATATAT
rJMFF040G14+ CATAGTATTGTGCAATTATATGAATGATACGGAGTAGAATGTTAACACAGCAATATATAT
rJMFF017H22+ CATAGTATTGTGCAATTATATGAATGATACGGAGTAGAATGTTAACACAGCAATATATAT
rJMFF007B06+ CATAGTATTGTGCAATTATATGAATGATACGGAGTAGAATGTTAACACAGCAATATATAT
rJMSF012C12+ CATAGTATTGTGCAATTATATGAATGATACGGAGTAGAATGTTAACACAGCAATATATAT
                      ____________________________________________________________
consensus CATAGTATTGTGCAATTATATGAATGATACGGAGTAGAATGTTAACACAGCAATATATAT
 
. : . : . : . : . : . :
rJMSF017C05+ AAAGGTGAAAACTGACGAATTGAAGCTAGATTGAATGAGTTGTGTTTGTAGTT
rJMFF040G14+ AAAGGTGAAAACTGACGAATTGAAGCTAGATTGAATGAGTTGTGTTTGTAGTTTGTACCA
rJMFF017H22+ AAAGGTGAAAACTGACGAATTGAAGCTAG
rJMFF007B06+ AAAGGTGAAAACTGACGAATTGAAGCTAGATTGAATGAGTTGTGTTTGTAGTTTGTACCA
rJMSF012C12+ AAAGGTGAAAACTGACGAATTGAAGCTAGATTGAATGAGTTGTGTTTGTAGTTTGTACCA
                      ____________________________________________________________
consensus AAAGGTGAAAACTGACGAATTGAAGCTAGATTGAATGAGTTGTGTTTGTAGTTTGTACCA
 
. : . : . : . : . : . :
rJMFF040G14+ AACTTGCATCTGTAGTAATAGATTTATGATTTT
rJMFF007B06+ AACTTGCATCTGTAGTAATAGATTTATGATTTTTGCATGTTTTGCTTCGTGTTGGTATCA
rJMSF012C12+ AACTTGCATCTGTAGTAATAGATTTATGATTTTTGCATGTTTTGCTTCGTGTTGGTATCA
                      ____________________________________________________________
consensus AACTTGCATCTGTAGTAATAGATTTATGATTTTTGCATGTTTTGCTTCGTGTTGGTATCA
 
. : . : . : . : . : . :
rJMFF007B06+ GTCCTTGTTGAGAAT
rJMSF012C12+ GTCCTTGTTGAGAATTGAAACAAGTTGTAATGGCAGTTAATGAATAGTTTATATATGGTG
                      ____________________________________________________________
consensus GTCCTTGTTGAGAATTGAAACAAGTTGTAATGGCAGTTAATGAATAGTTTATATATGGTG