Previous Contig 011672:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012C11Sequence500011672 (2)747011672 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012C11- GGACTTCATAACTTCATCTTTCTTTCTTCTTTTCTTTTGGAAATTGA
rJMSF012C11+ TCTTTCTTCTTTTCTTTGGGAAATTGA
                      ____________________________________________________________
consensus GGACTTCATAACTTCATCTTTCTTTCTTCTTTTCTTTTGGAAATTGA
 
. : . : . : . : . : . :
JMSF012C11- ACTTCATAACCGCTGGGCACTTTTTGAAACTTTGATCAGTAACCCATTTCAAAGAACTTG
rJMSF012C11+ ACTTCATAACCGCTGGGCACTTTTTGAAACTTTGATCAGTAACCCATTTCAAAGAACTTG
                      ____________________________________________________________
consensus ACTTCATAACCGCTGGGCACTTTTTGAAACTTTGATCAGTAACCCATTTCAAAGAACTTG
 
. : . : . : . : . : . :
JMSF012C11- AGGATGACTGCTTCCTATTTCGATGAGTACCTGAGGAAATTTTCCTAATTTCCCCCCTTT
rJMSF012C11+ AGGATGACTGCTTCCTATTTCGATGAGTACCTGAGGAAATTTTCCTAATTTCCCCCCTTT
                      ____________________________________________________________
consensus AGGATGACTGCTTCCTATTTCGATGAGTACCTGAGGAAATTTTCCTAATTTCCCCCCTTT
 
. : . : . : . : . : . :
JMSF012C11- GCTCATCCAAGCCACAGTTTGAAACTTTGAATGAATTAAAATCAACATCTAACTGTCTTG
rJMSF012C11+ GCTCATCCAAGCCACAGTTTGAAACTTTGAATGAATTAAAATCAACATCTAACTGTCTTG
                      ____________________________________________________________
consensus GCTCATCCAAGCCACAGTTTGAAACTTTGAATGAATTAAAATCAACATCTAACTGTCTTG
 
. : . : . : . : . : . :
JMSF012C11- AGAAGGATTTCTCATTATATAATTCTTTATGTTGGATGGTGTTTCTTAAATATCTTCTGA
rJMSF012C11+ AGAAGGATTTCTCATTATATAATTCTTTATGTTGGATGGTGTTTCTTAAATATCTTCTGA
                      ____________________________________________________________
consensus AGAAGGATTTCTCATTATATAATTCTTTATGTTGGATGGTGTTTCTTAAATATCTTCTGA
 
. : . : . : . : . : . :
JMSF012C11- CTGTTCTTTTCTTTGTAGGAAGCTTTCCAGAAAATGGCATGCCTATTTCCCTGGGTAGTA
rJMSF012C11+ CTGTTCTTTTCTTTGTAGGAAGCTTTCCAGAAAATGGCATGCCTATTTCCCTGGGTAGTA
                      ____________________________________________________________
consensus CTGTTCTTTTCTTTGTAGGAAGCTTTCCAGAAAATGGCATGCCTATTTCCCTGGGTAGTA
 
. : . : . : . : . : . :
JMSF012C11- GTTCAGACTCCAACACTCTTTCATCTTCCTGTGGTGTTTCAAAGTTACCAGGGATATTAC
rJMSF012C11+ GTTCAGACTCCAACACTCTTTCATCTTCCTGTGGTGTTTCAAAGTTACCAGGGATATTAC
                      ____________________________________________________________
consensus GTTCAGACTCCAACACTCTTTCATCTTCCTGTGGTGTTTCAAAGTTACCAGGGATATTAC
 
. : . : . : . : . : . :
JMSF012C11- CATACAACTTTTTGGCAGACTGCATCAATTGTTGTCCAGTACCTTCAGAATTAGTAGAAG
rJMSF012C11+ CATACAACTTTTTGGCAGACTGCATCAATTGTTGTCCAGTACCTTCAGAATTAGTAGAAG
                      ____________________________________________________________
consensus CATACAACTTTTTGGCAGACTGCATCAATTGTTGTCCAGTACCTTCAGAATTAGTAGAAG
 
. : . : . : . : . : . :
JMSF012C11- CCCCATTACAATGATCTACTGATACACTG
rJMSF012C11+ CCCCATTACAATGATCTACTGATACACTGTTTGAGGGATCACCGGAGAATTGGAGTGTTT
                      ____________________________________________________________
consensus CCCCATTACAATGATCTACTGATACACTGTTTGAGGGATCACCGGAGAATTGGAGTGTTT
 
. : . : . : . : . : . :
rJMSF012C11+ TTTGAGGACTCTTATGCTGGATGGTATTTCTCAAAGATCTTCTGCCTGTTCTTTTCTTTG
                      ____________________________________________________________
consensus TTTGAGGACTCTTATGCTGGATGGTATTTCTCAAAGATCTTCTGCCTGTTCTTTTCTTTG
 
. : . : . : . : . : . :
rJMSF012C11+ TGGGAAGCTTTCCAGAAAATGGCATGCATATTTCCCTTCGTAGTAGTTCGGATTCCAACA
                      ____________________________________________________________
consensus TGGGAAGCTTTCCAGAAAATGGCATGCATATTTCCCTTCGTAGTAGTTCGGATTCCAACA
 
. : . : . : . : . : . :
rJMSF012C11+ CTCTTTTGTCTTCCTGTGGTGTTTCAAAGTTACCAGGGATACTATCACACAACTTTCTGG
                      ____________________________________________________________
consensus CTCTTTTGTCTTCCTGTGGTGTTTCAAAGTTACCAGGGATACTATCACACAACTTTCTGG
 
. : . : . : . : . : . :
rJMSF012C11+ CAGACTGCATCAATTGATGTCCAGTGCCTTCAGAATTAGAAGAAACCCAATACAATGATC
                      ____________________________________________________________
consensus CAGACTGCATCAATTGATGTCCAGTGCCTTCAGAATTAGAAGAAACCCAATACAATGATC