Previous Contig 011670:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012B20Sequence249005665 (4)778011670 (3)pir|D86484|D864841e-38hypothetical protein F7F23.4 [imported] - Arabidopsis thaliana>gb:AE005172_89241
JMSF012G03Sequence259005665 (4)771011670 (3)pir|D86484|D864847e-44hypothetical protein F7F23.4 [imported] - Arabidopsis thaliana>gb:AE005172_89241
JMSF014I08Sequence248005665 (4)766011670 (3)pir|D86484|D864842e-57hypothetical protein F7F23.4 [imported] - Arabidopsis thaliana>gb:AE005172_89241

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014I08+ AGCGATGTCAGGAAAGA
                      ____________________________________________________________
consensus AGCGATGTCAGGAAAGA
 
. : . : . : . : . : . :
rJMSF014I08+ GCAAACACGGAGAGTGATCCTGGATTGAAACACAAACTACTCAGGCTTGGAAGGAAGCTG
                      ____________________________________________________________
consensus GCAAACACGGAGAGTGATCCTGGATTGAAACACAAACTACTCAGGCTTGGAAGGAAGCTG
 
. : . : . : . : . : . :
rJMSF014I08+ AAAGAGATTGACGATGATGTTCAAAGGCATAATGAACTTCTTGAGGTCATCAGGAGTTCA
                      ____________________________________________________________
consensus AAAGAGATTGACGATGATGTTCAAAGGCATAATGAACTTCTTGAGGTCATCAGGAGTTCA
 
. : . : . : . : . : . :
rJMSF014I08+ CCTTCTGAAATCAACGAGATTGTTACTCGACGTCGTAAAGATTTTACTAAAGAGTTCTTC
                      ____________________________________________________________
consensus CCTTCTGAAATCAACGAGATTGTTACTCGACGTCGTAAAGATTTTACTAAAGAGTTCTTC
 
. : . : . : . : . : . :
rJMSF014I08+ TTTCATGTTAACACTGTGGCGGAATCTTATTATGACAATCCAGATGAACAAAATGCGGTG
                      ____________________________________________________________
consensus TTTCATGTTAACACTGTGGCGGAATCTTATTATGACAATCCAGATGAACAAAATGCGGTG
 
. : . : . : . : . : . :
rJMSF014I08+ GCAAGGATTGGTAATGAGCGCTTGGAAGCTGTAGAAGCCTACGATACTGCAACTGAAAGT
                      ____________________________________________________________
consensus GCAAGGATTGGTAATGAGCGCTTGGAAGCTGTAGAAGCCTACGATACTGCAACTGAAAGT
 
. : . : . : . : . : . :
rJMSF014I08+ ATAGAGGCATTGAATGCAGCCGAGCTGAAACTGCAAGATATAGTCAATTCGCCTTCTTTG
                      ____________________________________________________________
consensus ATAGAGGCATTGAATGCAGCCGAGCTGAAACTGCAAGATATAGTCAATTCGCCTTCTTTG
 
. : . : . : . : . : . :
rJMSF014I08+ GATGCTGCTTGCAGGAAAATAGATGACCTAGCCCAGAAGAATCAATTTGACTCAGCATTG
                      ____________________________________________________________
consensus GATGCTGCTTGCAGGAAAATAGATGACCTAGCCCAGAAGAATCAATTTGACTCAGCATTG
 
. : . : . : . : . : . :
rJMSF014I08+ GCCCTCTTGATTACAAAAGCTTGGTCAGCAGCAAAGGAGTCTGACATGACACAGACTGAG
                      ____________________________________________________________
consensus GCCCTCTTGATTACAAAAGCTTGGTCAGCAGCAAAGGAGTCTGACATGACACAGACTGAG
 
. : . : . : . : . : . :
rJMSF014I08+ GACTCCGGAGCAGCTGCACAACTGGATTGGGATTATAGCTGATGCATATCACTTCAGCAG
rJMSF012G03+ GACTCCGGAGCAGCTGCACAACTGGATTGGGATTATAGCTGATGCATATCACTTCAGCAG
rJMSF012B20+ GACTCCGGAGCAGCTGCACAACTGGATTGGGATTATAGCTGATGCATATCACTTCAGCAG
                      ____________________________________________________________
consensus GACTCCGGAGCAGCTGCACAACTGGATTGGGATTATAGCTGATGCATATCACTTCAGCAG
 
. : . : . : . : . : . :
rJMSF014I08+ AGAAGGTACTCTCATTAGACAAGCTAGAGATTTAATGAACCCCAAAACAATCCAAAAACT
rJMSF012G03+ AGAAGGTACTCTCATTAGACAAGCTAGAGATTTAATGAACCCCAAAACAATCCAAAAACT
rJMSF012B20+ AGAAGGTACTCTCATTAGACAAGCTAGAGATTTAATGAACCCCAAAACAATCCAAAAACT
                      ____________________________________________________________
consensus AGAAGGTACTCTCATTAGACAAGCTAGAGATTTAATGAACCCCAAAACAATCCAAAAACT
 
. : . : . : . : . : . :
rJMSF014I08+ GGAAGAGTTGAAGAAGTTGATTCAGGACAAGTTCATGTAAGAGAGAATTTTGTTTGGGAC
rJMSF012G03+ GGAAGAGTTGAAGAAGTTGATTCAGGACAAGTTCATGTAAGAGAGAATTTTGTTTGGGAC
rJMSF012B20+ GGAAGAGTTGAAGAAGTTGATTCAGGACAAGTTCATGTAAGAGAGAATTTTGTTTGGGAC
                      ____________________________________________________________
consensus GGAAGAGTTGAAGAAGTTGATTCAGGACAAGTTCATGTAAGAGAGAATTTTGTTTGGGAC
 
. : . : . : . : . : . :
rJMSF014I08+ AGATAAATTATGCACTTCAGAAGTCTTTTAGTGATTTGTTGAATTGTGGTGCTGGAAGCC
rJMSF012G03+ AGATAAATTATGCACTTCAGAAGTCTTTTAGTGATTTGTTGAATTGTGGTGCTGGAAGCC
rJMSF012B20+ AGATAAATTATGCACTTCAGAAGTCTTTTAGTGATTTGTTGAATTGTGGTGCTGGAAGCC
                      ____________________________________________________________
consensus AGATAAATTATGCACTTCAGAAGTCTTTTAGTGATTTGTTGAATTGTGGTGCTGGAAGCC
 
. : . : . : . : . : . :
rJMSF014I08+ CAAAAGCACAAGTCTTGAAGCTCCACAAT
rJMSF012G03+ CAAAAGCACAAGTCTTGAAGCTCCACAATTATTGACTGCAATTTATCAAGCTTGGTAGGT
rJMSF012B20+ CAAAAGCACAAGTCTTGAAGCTCCACAATTATTGACTGCAATTTATCAAGCTTGGTAGGT
                      ____________________________________________________________
consensus CAAAAGCACAAGTCTTGAAGCTCCACAATTATTGACTGCAATTTATCAAGCTTGGTAGGT
 
. : . : . : . : . : . :
rJMSF012G03+ CCATCAAAAAGAAAGAAAAAGGTAATTTCCAGCCCCCAGAACCATTTGACTCAAATCTTG
rJMSF012B20+ CCATCAAAAAGAAAGAAAAAGGTAATTTCCAGCCCCCAGAACCATTTGACTCAAATCTTG
                      ____________________________________________________________
consensus CCATCAAAAAGAAAGAAAAAGGTAATTTCCAGCCCCCAGAACCATTTGACTCAAATCTTG
 
. : . : . : . : . : . :
rJMSF012G03+ ATAGTTGATATAATTTTTTAATATCATATATATAATACAGGAATCAAATGTGGAAACGTA
rJMSF012B20+ ATAGTTGATATAATTTTTTAATATCATATATATAATACAGGAATCAAATGTGGAAACGTA
                      ____________________________________________________________
consensus ATAGTTGATATAATTTTTTAATATCATATATATAATACAGGAATCAAATGTGGAAACGTA
 
. : . : . : . : . : . :
rJMSF012G03+ GGATCATAGTTATTAAGTTATTTTAATTTCATGTAGCTAGCCTAGTTGTTTGGAGCTGTA
rJMSF012B20+ GGATCATAGTTATTAAGTTATTTTAATTTCATGTAGCTAGCCTAGTTGTTTGGAGCTGTA
                      ____________________________________________________________
consensus GGATCATAGTTATTAAGTTATTTTAATTTCATGTAGCTAGCCTAGTTGTTTGGAGCTGTA
 
. : . : . : . : . : . :
rJMSF012G03+ AGAAAAGCTATGTATAGCAGTCTTCTGTTTTGTTGTAGTGAACCTGCAGAATT
rJMSF012B20+ AGAAAAGCTATGTATAGCAGTCTTCTGTTTTGTTGTAGTGAACCTGCAGAATTGGTGATT
                      ____________________________________________________________
consensus AGAAAAGCTATGTATAGCAGTCTTCTGTTTTGTTGTAGTGAACCTGCAGAATTGGTGATT