Previous Contig 011668:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012B15Sequence343011668 (3)gb:AY587772_16164999e-42Tamarix androssowii ubiquitin-conjugating enzyme family protein mRNA, complete c735011668 (3)gb:AY587772_16164992e-63Tamarix androssowii ubiquitin-conjugating enzyme family protein mRNA, complete c
JMSF020K11Sequence686001639 (5)pir|C86445|C864452e-77hypothetical protein F3C3.11 [imported] - Arabidopsis thaliana>gb:AE005172_89204700011668 (3)gb:AY587772_16164992e-69Tamarix androssowii ubiquitin-conjugating enzyme family protein mRNA, complete c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020K11+ GCCCGTCGAGTGGGTCTCCTTGCTGCTGCGGTTTCTC
                      ____________________________________________________________
consensus GCCCGTCGAGTGGGTCTCCTTGCTGCTGCGGTTTCTC
 
. : . : . : . : . : . :
JMSF012B15- AATGACGCTCGGT
rJMSF020K11+ GGAAACATTAAGGTCTGATCTTTACGGCTTTAATCTCTCTAACCGGAAATGACGCTCGGT
rJMSF012B15+ AATGACGCTCGGT
                      ____________________________________________________________
consensus GGAAACATTAAGGTCTGATCTTTACGGCTTTAATCTCTCTAACCGGAAATGACGCTCGGT
 
. : . : . : . : . : . :
JMSF012B15- GCCGGAGGATCTAGCGTAGTCGTTCCTAGGAATTTTAGGTTGCTCGAGGAGCTTGAACGT
rJMSF020K11+ GCCGGAGGATCTAGCGTAGTCGTTCCTAGGAATTTTAGGTTGCTCGAGGAGCTTGAACGT
rJMSF012B15+ GCCGGAGGATCTAGCGTAGTCGTTCCTAGGAATTTTAGGTTGCTCGAGGAGCTTGAACGT
                      ____________________________________________________________
consensus GCCGGAGGATCTAGCGTAGTCGTTCCTAGGAATTTTAGGTTGCTCGAGGAGCTTGAACGT
 
. : . : . : . : . : . :
JMSF012B15- GGAGAGAAAGGTATTGGAGACGGGTCTGTTAGCTATGGAATGGATGATGCTGATGATCTT
rJMSF020K11+ GGAGAGAAAGGTATTGGAGACGGGTCTGTTAGCTATGGAATGGATGATGCTGATGATCTT
rJMSF012B15+ GGAGAGAAAGGTATTGGAGACGGGTCTGTTAGCTATGGAATGGATGATGCTGATGATCTT
                      ____________________________________________________________
consensus GGAGAGAAAGGTATTGGAGACGGGTCTGTTAGCTATGGAATGGATGATGCTGATGATCTT
 
. : . : . : . : . : . :
JMSF012B15- TACATGCGTTCTTGGACGGGTACCATAATTGGTCCGCACAATACTGTACATGAGGGCCGT
rJMSF020K11+ TACATGCGTTCTTGGACGGGTACCATAATTGGTCCGCACAATACTGTACATGAGGGCCGT
rJMSF012B15+ TACATGCGTTCTTGGACGGGTACCATAATTGGTCCGCACAATACTGTACATGAGGGCCGT
                      ____________________________________________________________
consensus TACATGCGTTCTTGGACGGGTACCATAATTGGTCCGCACAATACTGTACATGAGGGCCGT
 
. : . : . : . : . : . :
JMSF012B15- ATTTATCAATTGAAGCTGTTTTGTGACAAAGATTATCCAGATAAGCCTCC
rJMSF020K11+ ATTTATCAATTGAAGCTGTTTTGTGACAAAGATTATCCAGATAAGCCTCCGAGTGTTCGT
rJMSF012B15+ ATTTATCAATTGAAGCTGTTTTGTGACAAAGATTATCCAGATAAGCCTCCGAGTGTTCGT
                      ____________________________________________________________
consensus ATTTATCAATTGAAGCTGTTTTGTGACAAAGATTATCCAGATAAGCCTCCGAGTGTTCGT
 
. : . : . : . : . : . :
rJMSF020K11+ TTCCATTCGTGCATCCACATGACCTGTGTCAACCCCGAGACTGGAGTGGTTGAACCAAAG
rJMSF012B15+ TTCCATTCGTGCATCCACATGACCTGTGTCAACCCCGAGACT--AGTGGTTGAACCAAAG
                      ____________________________________________________________
consensus TTCCATTCGTGCATCCACATGACCTGTGTCAACCCCGAGACTGGAGTGGTTGAACCAAAG
 
. : . : . : . : . : . :
rJMSF020K11+ AAGTTCAGTATGCTGTCAAATTGGCAGCGGGAGTACACGATGGAAGACATCCTGACTCAG
rJMSF012B15+ AAGTTCAGTATGCTGTCAAATTGGCAGCGGGAGTACACGATGGAAGACATCCTGACTCAG
                      ____________________________________________________________
consensus AAGTTCAGTATGCTGTCAAATTGGCAGCGGGAGTACACGATGGAAGACATCCTGACTCAG
 
. : . : . : . : . : . :
rJMSF020K11+ CTGCGAAAAGAAATGGCTGCATCTTACAACCGAAAGCTCGCTCAACCCCCAGAAGGTACC
rJMSF012B15+ CTGCGAAAAGAAATGGCTGCATCTTACAACCGAAAGCTCGCTCAACCCCCAGAAGGTACC
                      ____________________________________________________________
consensus CTGCGAAAAGAAATGGCTGCATCTTACAACCGAAAGCTCGCTCAACCCCCAGAAGGTACC
 
. : . : . : . : . : . :
rJMSF020K11+ TTTTTCTGATACCCTAAGCTGCAAG
rJMSF012B15+ TTTTTCTGATACCCTAAGCTGCAAGGAGGACCTATTATCAGATATTGCTGGATATGCTGA
                      ____________________________________________________________
consensus TTTTTCTGATACCCTAAGCTGCAAGGAGGACCTATTATCAGATATTGCTGGATATGCTGA
 
. : . : . : . : . : . :
rJMSF012B15+ CTGTATTTCTGAAATGTCCATAAATAGTTGCAAATTTATGTCGTAATGAATGTTACTACA
                      ____________________________________________________________
consensus CTGTATTTCTGAAATGTCCATAAATAGTTGCAAATTTATGTCGTAATGAATGTTACTACA
 
. : . : . : . : . : . :
rJMSF012B15+ CCAATATACATACCCCGCAAACCTTGCAATATCTTTCTTTCCATATGCATCATGCTTGTT
                      ____________________________________________________________
consensus CCAATATACATACCCCGCAAACCTTGCAATATCTTTCTTTCCATATGCATCATGCTTGTT
 
. : . : . : . : . : . :
rJMSF012B15+ CTGTGTTGTTCTAATTCCCCTTTGGATTAATGGATTCAGTGTTAAAGGAGAGATTGCCAT
                      ____________________________________________________________
consensus CTGTGTTGTTCTAATTCCCCTTTGGATTAATGGATTCAGTGTTAAAGGAGAGATTGCCAT