Previous Contig 011666:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050F21Sequence623005283 (2)gb:AC084766_17337692e-13Oryza sativa chromosome 3 BAC OSJNBb0048D20 genomic sequence, complete sequence.604011666 (2)
JMSF012A09Sequence216005283 (2)718011666 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012A09+ AAAGCAAAGGATTGATGAATATGTATATTCCCAGCTGATGCTGCAAACTGGTGGCCAG
                      ____________________________________________________________
consensus AAAGCAAAGGATTGATGAATATGTATATTCCCAGCTGATGCTGCAAACTGGTGGCCAG
 
. : . : . : . : . : . :
rJMFF050F21+ CAGTTGCAACAGACAATGCAGCTA
rJMSF012A09+ CAGCTTCAAGAAACAGTGCAGCTACAGCAATCATTACAGTTGCAACAGACAATGCAGCTA
                      ____________________________________________________________
consensus CAGCTTCAAGAAACAGTGCAGCTACAGCAATCATTACAGTTGCAACAGACAATGCAGCTA
 
. : . : . : . : . : . :
rJMFF050F21+ CAACAGCCAATACCCGATGCATCTGCTTCTCTGTTGCAAGGATATACTCAAGGGCACGGG
rJMSF012A09+ CAACAGCCAATACCCGATGCATCTGCTTCTCTGTTGCAAGGATATACTCAAGGGCACGGG
                      ____________________________________________________________
consensus CAACAGCCAATACCCGATGCATCTGCTTCTCTGTTGCAAGGATATACTCAAGGGCACGGG
 
. : . : . : . : . : . :
rJMFF050F21+ CTTTATGTTAACAGTAATCAAGGAGGTGCTATGATGGCATCCTACCCACAAGTCTACTCA
rJMSF012A09+ CTTTATGTTAACAGTAATCAAGGAGGTGCTATGATGGCATCCTACCCACAAGTCTACTCA
                      ____________________________________________________________
consensus CTTTATGTTAACAGTAATCAAGGAGGTGCTATGATGGCATCCTACCCACAAGTCTACTCA
 
. : . : . : . : . : . :
rJMFF050F21+ TCAACCGCAGCCAATCAAGCTCCCGCCTATTATGGTCAGTCATATTATCCCGCCCCTCCA
rJMSF012A09+ TCAACCGCAGCCAATCAAGCTCCCGCCTATTATGGTCAGTCATATTATCCCGCCCCTCCA
                      ____________________________________________________________
consensus TCAACCGCAGCCAATCAAGCTCCCGCCTATTATGGTCAGTCATATTATCCCGCCCCTCCA
 
. : . : . : . : . : . :
rJMFF050F21+ ATTTAGGCATGGCCATGAGTGTTGCTCTTTAACACCTTCCGCTTTAATCACATGATGGAT
rJMSF012A09+ ATTTAGGCATGGCCATGAGTGTTGCTCTTTAACACCTTCCGCTTTAATCACATGATGGAT
                      ____________________________________________________________
consensus ATTTAGGCATGGCCATGAGTGTTGCTCTTTAACACCTTCCGCTTTAATCACATGATGGAT
 
. : . : . : . : . : . :
rJMFF050F21+ GTACAAATAGTGAGTTATGCGGTGCTGAAATTACTCTTCCTATGAACTGTGATGTAGCTT
rJMSF012A09+ GTACAAATAGTGAGTTATGCGGTGCTGAAATTACTCTTCCTATGAACTGTGATGTAGCTT
                      ____________________________________________________________
consensus GTACAAATAGTGAGTTATGCGGTGCTGAAATTACTCTTCCTATGAACTGTGATGTAGCTT
 
. : . : . : . : . : . :
rJMFF050F21+ TTGTATTTTAACGATTGATTTTGATTTTACTTGGTAAAACGTCGTAGGACATAGCCTCTA
rJMSF012A09+ TTGTATTTTAACGATTGATTTTGATTTTACTTGGTAAAACGTCGTAGGACATAGCCTCTA
                      ____________________________________________________________
consensus TTGTATTTTAACGATTGATTTTGATTTTACTTGGTAAAACGTCGTAGGACATAGCCTCTA
 
. : . : . : . : . : . :
rJMFF050F21+ TTGCCTTGCCTCCTTGTTGAAATGTTGAGAATTAAGTTATTTTCTAGGTTTTCAAATCTC
rJMSF012A09+ TTGCCTTGCCTCCTTGTTGAAATGTTGAGAATTAAGTTATTTTCTAGGTTTTCAAATCTC
                      ____________________________________________________________
consensus TTGCCTTGCCTCCTTGTTGAAATGTTGAGAATTAAGTTATTTTCTAGGTTTTCAAATCTC
 
. : . : . : . : . : . :
rJMFF050F21+ TTAAACAGTTTGGTCATATCATCCAAGTGAAGTGTATGGTAGGCCTGCGAGTACTTTATT
rJMSF012A09+ TTAAACAGTTTGGTCATATCATCCAAGTGAAGTGTATGGTAGGCCTGCGAGTACTTTATT
                      ____________________________________________________________
consensus TTAAACAGTTTGGTCATATCATCCAAGTGAAGTGTATGGTAGGCCTGCGAGTACTTTATT
 
. : . : . : . : . : . :
rJMFF050F21+ TAGATAAGATAGCCATGTTTGTATCAGTGCTTGGATTATTATAATTTTAGTGGGAAAATT
rJMSF012A09+ TAGATAAGATAGCCATGTTTGTATCAGTGCTTGGATTATTATAATTTTAGTGGGAAAATT
                      ____________________________________________________________
consensus TAGATAAGATAGCCATGTTTGTATCAGTGCTTGGATTATTATAATTTTAGTGGGAAAATT
 
. : . : . : . : . : . :
rJMFF050F21+ TTCATATTGATGTAAA
rJMSF012A09+ TTCATATTGATGTAAATGACCAAACTGGGGCTGAGAAATCTCTGAAATTTCTCCCAAATT
                      ____________________________________________________________
consensus TTCATATTGATGTAAATGACCAAACTGGGGCTGAGAAATCTCTGAAATTTCTCCCAAATT