Previous Contig 011656:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011O03Sequence301011656 (2)404011656 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011O03- GGATATCTGAGTTGATCTTTAAGAAACACGACAACCCAGAAAAG
rJMSF011O03+ GGATATCTGAGTTGATCTTTAAGAAACACGACAACCCAGAAAAG
                      ____________________________________________________________
consensus GGATATCTGAGTTGATCTTTAAGAAACACGACAACCCAGAAAAG
 
. : . : . : . : . : . :
JMSF011O03- AGAAAAAGAGAAAAGAGAGAGAGAGAAGCTCAGCAGAAATGGCAGCAATGGTTGATGCCT
rJMSF011O03+ AGAAAAAGAGAAAAGAGAGAGAGAGAAGCTCAGCAGAAATGGCAGCAATGGTTGATGCCT
                      ____________________________________________________________
consensus AGAAAAAGAGAAAAGAGAGAGAGAGAAGCTCAGCAGAAATGGCAGCAATGGTTGATGCCT
 
. : . : . : . : . : . :
JMSF011O03- GTATGGTTCAGCTTGCAAAGCTGACAGAGAGAGTCCAGCCCAGAAAACTAGTCCTGCTCA
rJMSF011O03+ GTATGGTTCAGCTTGCAAAGCTGACAGAGAGAGTCCAGCCCAGAAAACTAGTCCTGCTCA
                      ____________________________________________________________
consensus GTATGGTTCAGCTTGCAAAGCTGACAGAGAGAGTCCAGCCCAGAAAACTAGTCCTGCTCA
 
. : . : . : . : . : . :
JMSF011O03- GAGCCAGAAAGACAGATTGTGTGGAAGCGGTTGAGGAAAGCAAGGCCGCCATTAAAGACT
rJMSF011O03+ GAGCCAGAAAGACAGATTGTGTGGAAGCGGTTGAGGAAAGCAAGGCCGCCATTAAAGACT
                      ____________________________________________________________
consensus GAGCCAGAAAGACAGATTGTGTGGAAGCGGTTGAGGAAAGCAAGGCCGCCATTAAAGACT
 
. : . : . : . : . : . :
JMSF011O03- CAGAAGCTCCTCTGCAATCATCTGCAGAAGCTGTGAATGATAACACCATGTCAGAAGCCA
rJMSF011O03+ CAGAAGCTCCTCTGCAATCATCTGCAGAAGCTGTGAATGATAACACCATGTCAGAAGCCA
                      ____________________________________________________________
consensus CAGAAGCTCCTCTGCAATCATCTGCAGAAGCTGTGAATGATAACACCATGTCAGAAGCCA
 
. : . : . : . : . : . :
JMSF011O03- CCGTTTTCTGGCTCATG
rJMSF011O03+ CCGTTTTCTGGCTCATGGATCGCTTTGCGCCGGCCTGATCGAACCAGACCAGAATCACAC
                      ____________________________________________________________
consensus CCGTTTTCTGGCTCATGGATCGCTTTGCGCCGGCCTGATCGAACCAGACCAGAATCACAC
 
. : . : . : . : . : . :
rJMSF011O03+ TTTCTGGGGCTGTATGTAAATCCTGTAATAGAGTTCCCTGTAATCTGTATGAATATATAG
                      ____________________________________________________________
consensus TTTCTGGGGCTGTATGTAAATCCTGTAATAGAGTTCCCTGTAATCTGTATGAATATATAG