Previous Contig 011655:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011N23Sequence226005275 (5)699011655 (5)pir|E84658|E846581e-50hypothetical protein At2g26280 [imported] - Arabidopsis thaliana>gb:AC004484_153
JMSF024H07Sequence654011655 (5)pir|E84658|E846585e-11hypothetical protein At2g26280 [imported] - Arabidopsis thaliana>gb:AC004484_153697011655 (5)pir|E84658|E846581e-47hypothetical protein At2g26280 [imported] - Arabidopsis thaliana>gb:AC004484_153
JMSF029F11Sequence274005275 (5)701011655 (5)pir|E84658|E846582e-38hypothetical protein At2g26280 [imported] - Arabidopsis thaliana>gb:AC004484_153
JMSF049H22Sequence345005275 (5)156011655 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024H07- GGG
                      ____________________________________________________________
consensus GGG
 
. : . : . : . : . : . :
JMSF024H07- CAGTCTATGGTGATAGGTTGCACAGCCGGGGGTCAACTCGTGCAGCTCCTGCCTGGCTTG
                      ____________________________________________________________
consensus CAGTCTATGGTGATAGGTTGCACAGCCGGGGGTCAACTCGTGCAGCTCCTGCCTGGCTTG
 
. : . : . : . : . : . :
JMSF024H07- AAACTGGAGAGGCAGTTGGTAATATTTTTCATGAAATTTTAGTTGTGGACAATATTTTAG
                      ____________________________________________________________
consensus AAACTGGAGAGGCAGTTGGTAATATTTTTCATGAAATTTTAGTTGTGGACAATATTTTAG
 
. : . : . : . : . : . :
JMSF024H07- AATGTATCTTCTTTAACGTTCTTTATATTGCAGCAAATATGTATTCTGAAATGCGGGAAG
                      ____________________________________________________________
consensus AATGTATCTTCTTTAACGTTCTTTATATTGCAGCAAATATGTATTCTGAAATGCGGGAAG
 
. : . : . : . : . : . :
JMSF024H07- AAGCTCGTGACCATGCACGTCTGCGCAATGCATACTTTGAACAGGTGCTTTTTTAAAATA
                      ____________________________________________________________
consensus AAGCTCGTGACCATGCACGTCTGCGCAATGCATACTTTGAACAGGTGCTTTTTTAAAATA
 
. : . : . : . : . : . :
JMSF024H07- ATAATAAAAATAAAATAAATGGTGTGGTGACAAAAGGCTGATTATCTTTGGTTCAAATGG
                      ____________________________________________________________
consensus ATAATAAAAATAAAATAAATGGTGTGGTGACAAAAGGCTGATTATCTTTGGTTCAAATGG
 
. : . : . : . : . : . :
JMSF024H07- CAAATGTGAGGTTTGGTTTTTGGGGGGTGGTTTCCATGGGGAGAAATCTTGTGTGGGGTG
                      ____________________________________________________________
consensus CAAATGTGAGGTTTGGTTTTTGGGGGGTGGTTTCCATGGGGAGAAATCTTGTGTGGGGTG
 
. : . : . : . : . : . :
JMSF024H07- TTTTAGTCCCTGCATATAGAGGCTACTCTATCCCAGTATATTTATGGGTATCGTAATTGT
                      ____________________________________________________________
consensus TTTTAGTCCCTGCATATAGAGGCTACTCTATCCCAGTATATTTATGGGTATCGTAATTGT
 
. : . : . : . : . : . :
JMSF024H07- TAATTGTAGTTTGTTTATTTGTTGACAGGAACATGTGGTAAAAGCTATTTATGGCTAACA
                      ____________________________________________________________
consensus TAATTGTAGTTTGTTTATTTGTTGACAGGAACATGTGGTAAAAGCTATTTATGGCTAACA
 
. : . : . : . : . : . :
JMSF024H07- TGTTTCTTTTATTTCACTGCTTAAAGATGAGATGCATATTCTTCTATGTGCCAAATCTGG
                      ____________________________________________________________
consensus TGTTTCTTTTATTTCACTGCTTAAAGATGAGATGCATATTCTTCTATGTGCCAAATCTGG
 
. : . : . : . : . : . :
JMSF024H07- ATATAGCTTCACCAGATACTGTTACTTTTGGGTTTTTTTATATGGTGTATTTACACTTTA
rJMSF024H07+ TTA
                      ____________________________________________________________
consensus ATATAGCTTCACCAGATACTGTTACTTTTGGGTTTTTTTATATGGTGTATTTACACTTTA
 
. : . : . : . : . : . :
JMSF024H07- ACCACTGGGATTTTATATGCAAGAGCAGGCTCGTCAGGCATACCTTAGTGG
rJMSF024H07+ ACCNCTGGGATTTTATATGCAAGAGCAGGCTCGTCAGGCATACCTTAGTGGTCAGAAGGC
rJMSF029F11+ CAGGCTCGTCAGGCATACCTTAGTGGTCAGAAGGC
rJMSF011N23+ CAGGCTCGTCAGGCATACCTTAGTGGTCAGAAGGC
                      ____________________________________________________________
consensus ACCACTGGGATTTTATATGCAAGAGCAGGCTCGTCAGGCATACCTTAGTGGTCAGAAGGC
 
. : . : . : . : . : . :
rJMSF024H07+ TTTAGCTAAAGAATTGAGTGAAAAAGGGCAGCTGCACAATA--AAAATGAAGGATGCTCA
rJMSF029F11+ TTTAGCTAAAGAATTGAGTGAAAAAGGGCAGCTGCNCAATATGAAAATGAAGGATGCTCC
rJMSF011N23+ TTTAGCTAAAGAATTGAGTGAAAAAGGGCAGNTGCNCNATATGCAAATGAAGGATGCTCA
                      ____________________________________________________________
consensus TTTAGCTAAAGAATTGAGTGAAAAAGGGCAGCTGCACAATATGAAAATGAAGGATGCTCA
 
. : . : . : . : . : . :
rJMSF024H07+ CGGCAGAGCTCAGGAATCTATATTCCGCGTAAGGAATCAAGAGGTGTCAACCAATGGCAG
rJMSF029F11+ CGGCAGAGCTCAGGAATNTATATTCCGCGTAAGGAATCAAGAGGTGTCAACCNATGGCNG
rJMSF011N23+ CGGCAGAGCTCAGGAATCTATATTCCGCGTAAGGAATCAAGAGGTGTCAACCAATGGCAG
                      ____________________________________________________________
consensus CGGCAGAGCTCAGGAATCTATATTCCGCGTAAGGAATCAAGAGGTGTCAACCAATGGCAG
 
. : . : . : . : . : . :
rJMSF024H07+ AGGACAGGAAAGAATTATTGACCTGCATGGACTTCATGTTTCAGAAGGTATTCAAGTCCT
rJMSF029F11+ NGGACNGGAAAGAATTATTGACCTGCNTGGACTTCATGTTTCAGAAGGTATTCAAGTCCT
rJMSF011N23+ AGGNCAGGAAAGAATTATTGNCCTGCATGGACTTCATGTTTCAGAAGGTATTCAAGTCCT
                      ____________________________________________________________
consensus AGGACAGGAAAGAATTATTGACCTGCATGGACTTCATGTTTCAGAAGGTATTCAAGTCCT
 
. : . : . : . : . : . :
rJMSF024H07+ TAAGCGCGAGCTAGCTGTTTTGAGAAACGCAGCAAGATCAGCAGATCAGCGGCTGCAGGT
rJMSF029F11+ TAAGCGCGAGCTAGCTGTTTTGAGAAACGCAGCAAGATCAGCAGATCAGCGGCTGCAGGT
rJMSF011N23+ TAAGCGCGAGCTAGCTGTTCTGAGAAACGCAGCAAGATCAGCAGATCANCGGCTGCAGGT
                      ____________________________________________________________
consensus TAAGCGCGAGCTAGCTGTTTTGAGAAACGCAGCAAGATCAGCAGATCAGCGGCTGCAGGT
 
. : . : . : . : . : . :
rJMSF024H07+ ATTCATTTGTGTCGGGACNGGGCATCACNCCAAGGGTTCAAGGACTCCAGCTAGACTTCC
rJMSF029F11+ ATTCATTTGTGTCGGGACNGGGCNTCNCCCCAAGGGTTCAAGGACTCCAGCTAGACTTCC
rJMSF011N23+ ATTCATTTGTGTCGGGACAGGGCATCACNCCAAGGGTTCAAGGACTCCAGCTAGACTTCC
                      ____________________________________________________________
consensus ATTCATTTGTGTCGGGACAGGGCATCACCCCAAGGGTTCAAGGACTCCAGCTAGACTTCC
 
. : . : . : . : . : . :
rJMSF024H07+ AACTGCCATCCAACGCTACCTCCTCGAGGAGGAAGGCCTTGACTACTCCGAACCNCAACC
rJMSF029F11+ AACTGCCATCCAACGCTACCTCCTCGAGGNGGAAGGCCTTGACTACTNCGAACCNCAACC
rJMSF011N23+ AACTGCCATCCAACGCTACCTCCTCGAGGAGGAAGGCCTTGACTACTCCGAACCACAACC
                      ____________________________________________________________
consensus AACTGCCATCCAACGCTACCTCCTCGAGGAGGAAGGCCTTGACTACTCCGAACCACAACC
 
. : . : . : . : . : . :
rJMSF024H07+ AGGGCTTNTCCGAGTTGTGGTATACTAAGTCAAGAAGGTATAGAAGTTTTTAACNCNGTA
rJMSF029F11+ NGGGNTTTTNCGAGTTGTGGTATACTAAGTCAAGAAGGTATAGAAGTTTTTAACCCNGTA
rJMSF011N23+ AGGGCTTCTNCGAGTTGTGGTATTCTAAGTCAAGAAGGTATAGAAGTTTTTAACCCNGTA
                      ____________________________________________________________
consensus AGGGCTTTTCCGAGTTGTGGTATACTAAGTCAAGAAGGTATAGAAGTTTTTAACCCNGTA
 
. : . : . : . : . : . :
rJMSF049H22+ GGAAAANTGTAGGGCAACTTCN
rJMSF024H07+ CNCCCTTGAAATGTGTTATATTTGTGGTATCTGTATATGGAAAAGTGTAGTGCAACTTCN
rJMSF029F11+ CNCCCNTGAAATGTGTTATATTTGTGGTATCNGTATATGGAAAAGTGTAGNGCAACTTCN
rJMSF011N23+ CNCCCTTGAAATGTGTTATATTNGTGGTATNTGTATATGGAAAAGTGTAGTGCAACTTCA
                      ____________________________________________________________
consensus CNCCCTTGAAATGTGTTATATTTGTGGTATCTGTATATGGAAAAGTGTAGTGCAACTTCA
 
. : . : . : . : . : . :
rJMSF049H22+ CGGAGTAGGGAGGAAAAGAAAATG-NNAAANAAANTCNGCGACAAGGGGCNGAGATTNGT
rJMSF024H07+ CGGAGTAGGGAGGAAAAGAAAAAG-AAAAAAAAAATCTGCGACAAGGGGCAGAGATTTGT
rJMSF029F11+ CGGAGTAGGGNGGAAAAGAAAAAGAAAAAAAAAAATCTGCGACAAGGGGCAGAGATTTGT
rJMSF011N23+ CGGNGTAGGGAGGAAAAGAAAAAG-AAAAAAAAAATCTGCGACAAGGGGCAGAGATTTGT
                      ____________________________________________________________
consensus CGGAGTAGGGAGGAAAAGAAAAAG-AAAAAAAAAATCTGCGACAAGGGGCAGAGATTTGT
 
. : . : . : . : . : . :
rJMSF049H22+ ATCAGTAAGGTTTAGTTGTTTGATAGTGGGATATGGGNGGAGNCTGTATCAGTCCCATGC
rJMSF024H07+ ATCAGTAAGGTTTAGTTGTTTGATAGTGGGATATGGGAGGAGGGTGTATCAGTCCCATGC
rJMSF029F11+ ATCAGTAAGGTTTAGTTGTTTGATAGTGGGATATGGGAGGAGGGTGTATCAGTCCCATGC
rJMSF011N23+ ATCAGTAAGGTTTAGTTGTTTGATAGTGGGATATGGGAGGAGGGTGTATCAGTCCCATGC
                      ____________________________________________________________
consensus ATCAGTAAGGTTTAGTTGTTTGATAGTGGGATATGGGAGGAGGGTGTATCAGTCCCATGC
 
. : . : . : . : . : . :
rJMSF049H22+ TAGTTTTGTTAC
rJMSF024H07+ TAGTTTTGTTACGTTAATTTTGTCTAAATTGCCCA
rJMSF029F11+ TAGTTTTGTTACGTTAATTTTGTCTAAATTGCCCAATGTAACTGATAAAATTCATT
rJMSF011N23+ TAGTTTTGTTACGTTAATTTTGTCTAAATTGCCCAATGTAACTGATAAAATTCATTATTG
                      ____________________________________________________________
consensus TAGTTTTGTTACGTTAATTTTGTCTAAATTGCCCAATGTAACTGATAAAATTCATTATTG