Previous Contig 011654:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024B01Sequence558011654 (7)gb:AC096688_17362461e-40Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence.
JMFN034C11Sequence649011654 (7)gb:AC096688_17362465e-46Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence.
JMSF006A06Sequence256005282 (5)345011654 (7)gb:AC096688_17362466e-24Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence.
JMSF006C08Sequence327011654 (7)211011654 (7)gb:AC096688_17362460.040Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence.
JMSF011N22Sequence291011654 (7)714011654 (7)gb:AC096688_17362463e-41Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011N22- GATCACACGTTAAAGCCGCGGAGGGGATGTTTTG
                      ____________________________________________________________
consensus GATCACACGTTAAAGCCGCGGAGGGGATGTTTTG
 
. : . : . : . : . : . :
JMSF011N22- CCGATTAGGGTAGCGGACGAGCGGTAACGATCGAGGAAAGACTGCGCCCCTTCTACTTTG
JMSF006C08- GCCCCTTCTACTTTG
JMFN034C11- GCCCCTTCTACTTTG
                      ____________________________________________________________
consensus CCGATTAGGGTAGCGGACGAGCGGTAACGATCGAGGAAAGACTGCGCCCCTTCTACTTTG
 
. : . : . : . : . : . :
JMSF011N22- ATTTGAACGAACGAACGAACGAAGAAGCAACACGCCATGTCTTCTACGGTGGCGCTACAA
JMSF006C08- ATTTGAACGAACGAACGAACGAAGAAGCAACACGCCATGTCTTCTACGGTGGCGCTACAA
JMFN034C11- ATTTGAACGAACGAACGAACGAAGAAGCAACACGCCATGTCTTCTACGGTGGCGCTACAA
rJMSF011N22+ ATTTGAACGAACGAACGAACGAAGAAGCAACACGCCATGTCTTCTACGGTGGCGCTACAA
                      ____________________________________________________________
consensus ATTTGAACGAACGAACGAACGAAGAAGCAACACGCCATGTCTTCTACGGTGGCGCTACAA
 
. : . : . : . : . : . :
JMSF011N22- TCGCAGATAGCTTTCACGACTGCGCCTCTCTTCGTAAGAGCGGCCACCAC-TACTGCTAC
JMSF006C08- TCGCAGATAGCTTTCACGACTGCGCCTCTCTTCGTAAGAGCGGCCACCAC-TACTGCTAC
JMFN034C11- TCGCAGATAGCTTTCACGACTGCGCCTCTCTTCGTAAGAGCGGCCACCAC-TACTGCTAC
rJMFF024B01+ TTCGTAAGAGCGGCCACCACTTACTGCTAC
rJMSF011N22+ TCGCAGATAGCTTTCACGACTGCGCCTCTCTTCGTAAGAGCGGCCACCAC-TACTGCTAC
                      ____________________________________________________________
consensus TCGCAGATAGCTTTCACGACTGCGCCTCTCTTCGTAAGAGCGGCCACCAC-TACTGCTAC
 
. : . : . : . : . : . :
JMSF011N22- GCCTAATGTCAATGTTTCTCTGGTGCACGCCCCGACTCCTTATCGTCGTGCACTTCGCTG
JMSF006C08- GCCTAATGTCAATGTTTCTCTGGTGCACGCCCCGACTCCTTATCGTCGTGCACTTCGCTG
JMFN034C11- GCCTAATGTCAATGTTTCTCTGGTGCACGCCCCGACTCCTTATCGTCGTGCACTTCGCTG
rJMFF024B01+ GCCTAATGTCAATGTTTCTCTGGTGCACGCCCCGACTCCTTATCGTCGTGCACTTCGCTG
rJMSF011N22+ GCCTAATGTCAATGTTTCTCTGGTGCACGCCCCGACTCCTTATCGTCGTGCACTTCGCTG
                      ____________________________________________________________
consensus GCCTAATGTCAATGTTTCTCTGGTGCACGCCCCGACTCCTTATCGTCGTGCACTTCGCTG
 
. : . : . : . : . : . :
JMSF011N22- CTCCACAAATCGAAATAG
JMSF006C08- CTCCACAAATCGAAATAGCGCTATCGTCGGCAGAAACCGTTCTGGAAGGACCGGATCCGG
JMFN034C11- CTCCACAAATCGAAATAGCGCTATCGTCGGCAGAAACCGTTCTGGAAGGACCGGATCCGG
rJMFF024B01+ CTCCACAAATCGAAATAGCGCTATCGTCGGCAGAAACCGTTNTGGAAGGACCGGATCCGG
rJMSF011N22+ CTCCACAAATCGAAATAGCGCTATCGTCGGCAGAAACCGTTCTGGAAGGACCGGATCCGG
                      ____________________________________________________________
consensus CTCCACAAATCGAAATAGCGCTATCGTCGGCAGAAACCGTTCTGGAAGGACCGGATCCGG
 
. : . : . : . : . : . :
JMSF006C08- ATCCGGATCATTTCGATGCTTATGCGCTCTAAGTCCTGAGTTGAAGACTACTTTGGATAA
JMFN034C11- ATCCGGATCATTTCGATGCTTATGCGCTCTAAGTCCTGAGTTGAAGACTACTTTGGATAA
rJMFF024B01+ ATCCGGATCATTTGGATGCTTATGCGCTCTAAGTCCTGAGTTGAAGATTACTTTGGATAA
rJMSF011N22+ ATCCGGATCATTTCGATGCTTATGCGCTCTAAGTCCTGAGTTGAAGACTACTTTGGATAA
                      ____________________________________________________________
consensus ATCCGGATCATTTCGATGCTTATGCGCTCTAAGTCCTGAGTTGAAGACTACTTTGGATAA
 
. : . : . : . : . : . :
JMSF006C08- AGTTGTTACA
JMFN034C11- AGTTGTTACATCAGACAAAGTTGTGTTGTTCATGAAAGGAACCAAGGAATTTCCACAATG
rJMFF024B01+ AGTTGTTACATCAGACAAAGTTGTGTTGTTCATGAAAGGAACCAAGGAATTTCCACAATG
rJMSF011N22+ AGTTGTTACATCAGACAAAGTTGTGTTGTTCATGAAAGGAACCAAGGAATTTCCACAATG
                      ____________________________________________________________
consensus AGTTGTTACATCAGACAAAGTTGTGTTGTTCATGAAAGGAACCAAGGAATTTCCACAATG
 
. : . : . : . : . : . :
JMFN034C11- TGGATTCTCCAACACAGTGGTGCAGATACTAAAGTCCTTGAACATGCCTTTTGAGACAAT
rJMFF024B01+ TGGATTCTCCANCACAGTGGTGCNGATACTAAAGTCCTTGAACATGCNTTNTGAGACAAT
rJMSF006A06+ CACAGTGGTGCAGATACTAAAGTCCTTGAACATGCCNTTTGAGACANT
rJMSF011N22+ TGGATTCTCCAACACAGTGGTGCAGATACTAAAGTCCTTGAACATGCCTTTTGAGACAAT
                      ____________________________________________________________
consensus TGGATTCTCCAACACAGTGGTGCAGATACTAAAGTCCTTGAACATGCCTTTTGAGACAAT
 
. : . : . : . : . : . :
JMFN034C11- AAATATCCTTGAAAATGAAGTGTTGCGACAAGGATTGAAGGAGTATTCCAGTTGGCCAAC
rJMFF024B01+ AAATATCCTTGAAAATGAAGTGTTGNGACAAGGATTGAAGGAGTATTCCAGTTGGCCAAC
rJMSF006A06+ AAANATCCTTGAAACNGAAGTGTTGCGACAAGGATTGAAGGAGTATTCCAGTTGGCCAAC
rJMSF011N22+ AAATATCCTTGAAAATGAAGTGTTGCGACAAGGATTGAAGGAGTATTCCAGTTGGCCAAC
                      ____________________________________________________________
consensus AAATATCCTTGAAAATGAAGTGTTGCGACAAGGATTGAAGGAGTATTCCAGTTGGCCAAC
 
. : . : . : . : . : . :
JMFN034C11- CTTTCCTCAGCTCTACATTGATGGGGAATTTTTTGGTGGTTGTGACATCACA-----GTA
rJMFF024B01+ CTTTCCTCAGNTGTACANTGATGGGGAATTTTTNGGAGGTTGTGACATCACA-----GTA
rJMSF006A06+ CTTTCNTCAGCTCNACATTGATGGGGAANTTTCTGGTGGTTGTGACATCAC-----NGTA
rJMSF006C08+ CATCACNGTA
rJMSF011N22+ CTTTCCTCAGCTCTACATTGATGGGGAATTTTTTGGTGGTTGTGACATCACAGTA-GGTA
                      ____________________________________________________________
consensus CTTTCCTCAGCTCTACATTGATGGGGAATTTTTTGGTGGTTGTGACATCACA----GGTA
 
. : . : . : . : . : . :
JMFN034C11- GAGGCATACAAGAGCGGAGAGCTGCAAGAAGTGCTTGAAAA-GACAATGTGCTCTTGATA
rJMFF024B01+ GAGGCATACAAGAGCGGAGAGCTGCAAGAAGTGCTTGAAAA-GACAATGTGCTCTTGATA
rJMSF006A06+ GAGGCNTACAAGAGCGGAGAGCTGCAAGAAGTGCTTGANAA-GACAATGTGCTCTTGATC
rJMSF006C08+ GAGGCATACANGAGCGGAGAGCTGCAAGAAGTGCTTGAAAACGACAATGTGCTCATGATA
rJMSF011N22+ GAGGCATACAAGAGCGGAGAGCTGCAAGAAGTGCTTGAAAA-GACAATGTGCTCTTGATA
                      ____________________________________________________________
consensus GAGGCATACAAGAGCGGAGAGCTGCAAGAAGTGCTTGAAAA-GACAATGTGCTCTTGATA
 
. : . : . : . : . : . :
JMFN034C11- GGTTGAAA-TATAGACA-TTTGATGCCATNC-AATTGCAAAGT
rJMFF024B01+ GGTTGAAA-TATAGACA-TNTGATGCCAT-CAAATTGCAAAGTAGCAGCATCATAAT
rJMSF006A06+ GGTTGAAA-TATAGACA-TTTGACCCCATCCAAATCGCAAAGTCGCAGCATCATAATCCT
rJMSF006C08+ GGTTGAAAGTATANACAGTTTGATGCCAT-CAAATTGCAAAGTNGCNGCATCATAATCCT
rJMSF011N22+ GGTTGAAA-TATAGACA-TTTGATGCCAT-CAAATTGCAAAGTAGCAGCATCATAATCCT
                      ____________________________________________________________
consensus GGTTGAAA-TATAGACA-TTTGATGCCATCCAAATTGCAAAGTAGCAGCATCATAATCCT
 
. : . : . : . : . : . :
rJMSF006A06+ CAAACAATG
rJMSF006C08+ AAAACAATG
rJMSF011N22+ AAAACAATGTTATGAAATGTCTTATTCTGTCATCCAAATGATATGAATGTAGGGTGTCAG
                      ____________________________________________________________
consensus AAAACAATGTTATGAAATGTCTTATTCTGTCATCCAAATGATATGAATGTAGGGTGTCAG