Previous Contig 011647:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011F15Sequence255007997 (5)739011647 (5)gb:AY054634_15632889e-64Arabidopsis thaliana putative protein (F24B22.22) mRNA, complete cds.>gb:AY08151
JMSF011L23Sequence272007997 (5)736011647 (5)gb:AY054634_15632882e-62Arabidopsis thaliana putative protein (F24B22.22) mRNA, complete cds.>gb:AY08151
JMSF015O20Sequence247007997 (5)745011647 (5)gb:AY054634_15632885e-64Arabidopsis thaliana putative protein (F24B22.22) mRNA, complete cds.>gb:AY08151
JMSF050G23Sequence621007997 (5)gb:AY054634_15632882e-33Arabidopsis thaliana putative protein (F24B22.22) mRNA, complete cds.>gb:AY08151702011647 (5)gb:AY054634_15632888e-59Arabidopsis thaliana putative protein (F24B22.22) mRNA, complete cds.>gb:AY08151
JMSF050J02Sequence640007997 (5)gb:AY054634_15632886e-58Arabidopsis thaliana putative protein (F24B22.22) mRNA, complete cds.>gb:AY08151705011647 (5)gb:AY054634_15632883e-60Arabidopsis thaliana putative protein (F24B22.22) mRNA, complete cds.>gb:AY08151

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015O20+ GTGGAATGAAGCAAGGAGCAGAAAAC
rJMSF011F15+ GGAGCAGAAAAC
rJMSF011L23+ GGAGCAGAAACC
                      ____________________________________________________________
consensus GTGGAATGAAGCAAGGAGCAGAAAAC
 
. : . : . : . : . : . :
rJMSF015O20+ AAGAGAATACTGCATCTTGATTTGATAGAAGAGAATGCAAGGTACTGGAGAGGCTCTGAT
rJMSF050J02+ GCATCTTGATTTGATAGAAGAGAATGCAAGGTACTGGAGAGGCTCTGAT
rJMSF050G23+ TGATTTGATAGAAGAGAATGCAAGGTACTGGAGAGGCTCTGAT
rJMSF011F15+ AAGAGAATACTGCATCTTGATTTGATAGAAGAGAATGCAAGGTACTGGAGAGGCTCTGAT
rJMSF011L23+ AAGAGAATACTGCATCTTGATTTGATAGAAGAGAATGCAAGGTACTGGAGAGGCTCTGAT
                      ____________________________________________________________
consensus AAGAGAATACTGCATCTTGATTTGATAGAAGAGAATGCAAGGTACTGGAGAGGCTCTGAT
 
. : . : . : . : . : . :
rJMSF015O20+ GTGCTTGTGTTTGATTCAGCTCATTGGTGGACTCATTCTCAAAACCGGAGCTCGTGGGAT
rJMSF050J02+ GTGCTTGTGTTTGATTCAGCTCATTGGTGGACTCATTCTCAAAACCGGAGCTCGTGGGAT
rJMSF050G23+ GTGCTTGTGTTTGATTCAGCTCATTGGTGGACTCATTCTCAAAACCGGAGCTCGTGGGAT
rJMSF011F15+ GTGCTTGTGTTTGATTCAGCTCATTGGTGGACTCATTCTCAAAACCGGAGCTCGTGGGAT
rJMSF011L23+ GTGCTTGTGTTTGATTCAGCTCATTGGTGGACTCATTCTCAAAACCGGAGCTCGTGGGAT
                      ____________________________________________________________
consensus GTGCTTGTGTTTGATTCAGCTCATTGGTGGACTCATTCTCAAAACCGGAGCTCGTGGGAT
 
. : . : . : . : . : . :
rJMSF015O20+ TATATTATGGAGGGTACCAATTTCTTCAGATATATGAACCCTATGGTTGCCTATGAGAAA
rJMSF050J02+ TATATTATGGAGGGTACCAATTTCTTCAGATATATGAACCCTATGGTTGCCTATGAGAAA
rJMSF050G23+ TATATTATGGAGGGTACCAATTTCTTCAGATATATGAACCCTATGGTTGCCTATGAGAAA
rJMSF011F15+ TATATTATGGAGGGTACCAATTTCTTCAGATATATGAACCCTATGGTTGCCTATGAGAAA
rJMSF011L23+ TATATTATGGAGGGTACCAATTTCTTCAGATATATGAACCCTATGGTTGCCTATGAGAAA
                      ____________________________________________________________
consensus TATATTATGGAGGGTACCAATTTCTTCAGATATATGAACCCTATGGTTGCCTATGAGAAA
 
. : . : . : . : . : . :
rJMSF015O20+ GGGCTCATGACATGGGCTAAATGGATAGACTTAAACGTCGATCCCAGGAAAAGCCGAGTC
rJMSF050J02+ GGGCTCATGACATGGGCTAAATGGATAGACTTAAACGTCGATCCCAGGAAAAGCCGAGTC
rJMSF050G23+ GGGCTCATGACATGGGCTAAATGGATAGACTTAAACGTCGATCCCAGGAAAAGCCGAGTC
rJMSF011F15+ GGGCTCATGACATGGGCTAAATGGATAGACTTAAACGTCGATCCCAGGAAAAGCCGAGTC
rJMSF011L23+ GGGCTCATGACATGGGCTAAATGGATAGACTTAAACGTCGATCCCAGGAAAAGCCGAGTC
                      ____________________________________________________________
consensus GGGCTCATGACATGGGCTAAATGGATAGACTTAAACGTCGATCCCAGGAAAAGCCGAGTC
 
. : . : . : . : . : . :
rJMSF015O20+ TTCTTCAGAAGCATGTCGCCTAAGCATAACAGAGAAAACGGGTGGAAATGTTTCAACGAG
rJMSF050J02+ TTCTTCAGAAGCATGTCGCCTAAGCATAACAGAGAAAACGGGTGGAAATGTTTCAACGAG
rJMSF050G23+ TTCTTCAGAAGCATGTCGCCTAAGCATAACAGAGAAAACGGGTGGAAATGTTTCAACGAG
rJMSF011F15+ TTCTTCAGAAGCATGTCGCCTAAGCATAACAGAGAAAACGGGTGGAAATGTTTCAACGAG
rJMSF011L23+ TTCTTCAGAAGCATGTCGCCTAAGCATAACAGAGAAAACGGGTGGAAATGTTTCAACGAG
                      ____________________________________________________________
consensus TTCTTCAGAAGCATGTCGCCTAAGCATAACAGAGAAAACGGGTGGAAATGTTTCAACGAG
 
. : . : . : . : . : . :
rJMSF015O20+ AGGGAGCCTCTGGAGCACTTTAGTCGCCCCCGAGTACCTCAACAGCTGGTGGTACTAAAA
rJMSF050J02+ AGGGAGCCTCTGGAGCACTTTAGTCGCCCCCGAGTACCTCAACAGCTGGTGGTACTAAAA
rJMSF050G23+ AGGGAGCCTCTGGAGCACTTTAGTCGCCCCCGAGTACCTCAACAGCTGGTGGTACTAAAA
rJMSF011F15+ AGGGAGCCTCTGGAGCACTTTAGTCGCCCCCGAGTACCTCAACAGCTGGTGGTACTAAAA
rJMSF011L23+ AGGGAGCCTCTGGAGCACTTTAGTCGCCCCCGAGTACCTCAACAGCTGGTGGTACTAAAA
                      ____________________________________________________________
consensus AGGGAGCCTCTGGAGCACTTTAGTCGCCCCCGAGTACCTCAACAGCTGGTGGTACTAAAA
 
. : . : . : . : . : . :
rJMSF015O20+ CAGGTGCTGAGAAGGATGAACTTCCCGGTGTATTTGCAGGATATCAGTACAATGTCAGCG
rJMSF050J02+ CAGGTGCTGAGAAGGATGAACTTCCCGGTGTATTTGCAGGATATCAGTACAATGTCAGCG
rJMSF050G23+ CAGGTGCTGAGAAGGATGAACTTCCCGGTGTATTTGCAGGATATCAGTACAATGTCAGCG
rJMSF011F15+ CAGGTGCTGAGAAGGATGAACTTCCCGGTGTATTTGCAGGATATCAGTACAATGTCAGCG
rJMSF011L23+ CAGGTGCTGAGAAGGATGAACTTCCCGGTGTATTTGCAGGATATCAGTACAATGTCAGCG
                      ____________________________________________________________
consensus CAGGTGCTGAGAAGGATGAACTTCCCGGTGTATTTGCAGGATATCAGTACAATGTCAGCG
 
. : . : . : . : . : . :
rJMSF015O20+ TTTAGAAGAGACGCTCATCCCTCCGTTTATGGTAAAGTCGTAGGTCAAGAAGAGAAGCAG
rJMSF050J02+ TTTAGAAGAGACGCTCATCCCTCCGTTTATGGTAAAGTCGTAGGTCAAGAAGAGAAGCAG
rJMSF050G23+ TTTAGAAGAGACGCTCATCCCTCCGTTTATGGTAAAGTCGTAGGTCAAGAAGAGAAGCAG
rJMSF011F15+ TTTAGAAGAGACGCTCATCCCTCCGTTTATGGTAAAGTCGTAGGTCAAGAAGAGAAGCAG
rJMSF011L23+ TTTAGAAGAGACGCTCATCCCTCCGTTTGTGGTAAAGTCGTAGGTCAAGAAGAGAAGCAG
                      ____________________________________________________________
consensus TTTAGAAGAGACGCTCATCCCTCCGTTTATGGTAAAGTCGTAGGTCAAGAAGAGAAGCAG
 
. : . : . : . : . : . :
rJMSF015O20+ CACCTCCGAGGCTACAAATCCGATTGTAGCCACTGGTGCCTTCCTGGCGTGCCCGATATT
rJMSF050J02+ CACCTCCGAGGCTACAAATCCGATTGTAGCCACTGGTGCCTTCCTGGCGTGCCCGATATT
rJMSF050G23+ CACCTCCGAGGCTACAAATCCGATTGTAGCCACTGGTGCCTTCCTGGCGTGCCCGATATT
rJMSF011F15+ CACCTCCGAGGCTACAAATCCGATTGTAGCCACTGGTGCCTTCCTGGCGTGCCCGATATT
rJMSF011L23+ CACCTCCGAGGCTACAAATCCGATTGTAGCCACTGGTGCCTTCCTGGCGTGCCCGATATT
                      ____________________________________________________________
consensus CACCTCCGAGGCTACAAATCCGATTGTAGCCACTGGTGCCTTCCTGGCGTGCCCGATATT
 
. : . : . : . : . : . :
rJMSF015O20+ TGGAATGAGATGTTGAATGCCATGCTCTAGAGCCTTAGCTTGTCTCTAAGTGTGAAAGGT
rJMSF050J02+ TGGAATGAGATGTTGAATGCCATGCTCTAGAGCCTTAGCTTGTCTCTAAGTGTGAAAGGT
rJMSF050G23+ TGGAATGAGATGTTGAATGCCATGCTCTAGAGCCTTAGCTTGTCTCTAAGTGTGAAAGGT
rJMSF011F15+ TGGAATGAGATGTTGAATGCCATGCTCTAGAGCCTTAGCTTGTCTCTAAGTGTGAAAGGT
rJMSF011L23+ TGGAATGAGATGTTGAATGCCATGCTCTAGAGCCTTAGCTTGTCTCTAAGTGTGAAAGGT
                      ____________________________________________________________
consensus TGGAATGAGATGTTGAATGCCATGCTCTAGAGCCTTAGCTTGTCTCTAAGTGTGAAAGGT
 
. : . : . : . : . : . :
rJMSF015O20+ GTCTCATGCTGTATAAGCTCTAGGGATGGGTCATTGAGATCTCTTGTCTCAAAAGATCTG
rJMSF050J02+ GTCTCATGCTGTATAAGCTCTAGGGATGGGTCATTGAGATCTCTTGTCTCAAAAGATCTG
rJMSF050G23+ GTCTCATGCTGTATAAGCTCTAGGGATGGGTCATTGAGATCTCTTGTCTCAAAAGATCTG
rJMSF011F15+ GTCTCATGCTGTATAAGCTCTAGGGATGGGTCATTGAGATCTCTTGTCTCAAAAGATCTG
rJMSF011L23+ GTCTCATGCTGTATAAGCTCTAGGGATGGGTCATTGAGATCTCTTGTCTCAAAAGATCTG
                      ____________________________________________________________
consensus GTCTCATGCTGTATAAGCTCTAGGGATGGGTCATTGAGATCTCTTGTCTCAAAAGATCTG
 
. : . : . : . : . : . :
rJMSF015O20+ TTGAGTTTCTTTTCCCTTTTCTCTTTCTTTCTTTGTGAAAAGTTGTTGAC
rJMSF050J02+ TTGAGTTTCTTTTCCCTTTTCTCTTTCTTTCTTTGTGAAAAGTTGT
rJMSF050G23+ TTGAGTTTCTTTTCCCTTTTCTCTTTCTTTCTTTGTGAAAAGTTGTTGAC
rJMSF011F15+ TTGAGTTTCTTTTCCCTTTTCTCTTTCTTTCTTTGTGAAAAGTTGTTGAC
rJMSF011L23+ TTGAGTTTCTTTTCCCTTTTCTCTTTCTTTCTTTGTGAAAAGTTGTTGACCTTGAGTTAA
                      ____________________________________________________________
consensus TTGAGTTTCTTTTCCCTTTTCTCTTTCTTTCTTTGTGAAAAGTTGTTGACCTTGAGTTAA