Previous Contig 011643:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS115G04Sequence487011643 (3)gb:AY062680_15653362e-20Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF011L03Sequence367007962 (8)gb:AY062680_15653366e-19Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.737011643 (3)gb:AY062680_15653363e-58Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF050A22Sequence615007962 (8)gb:AY062680_15653363e-47Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.725011643 (3)gb:AY050535_15622633e-62Arabidopsis thaliana leucine-rich repeat receptor-like kinase F21M12.36 mRNA, co

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF050A22+ TGCGACCGCCCCATCATCCACCGGGATGTCAAGTCCAGTAATATCTTATTGGACGA
                      ____________________________________________________________
consensus TGCGACCGCCCCATCATCCACCGGGATGTCAAGTCCAGTAATATCTTATTGGACGA
 
. : . : . : . : . : . :
rJMSF050A22+ GTTTTTCAAGCCCAGAATTGCAGATTTTGGTCTGGCAAAGATTCTCCAATATAACAGCTC
                      ____________________________________________________________
consensus GTTTTTCAAGCCCAGAATTGCAGATTTTGGTCTGGCAAAGATTCTCCAATATAACAGCTC
 
. : . : . : . : . : . :
rJMSF050A22+ TTGTAAAGACACCACTCATGTCATTCCAGGAACTCATGGATACATCGCTCCAGGTACAAA
                      ____________________________________________________________
consensus TTGTAAAGACACCACTCATGTCATTCCAGGAACTCATGGATACATCGCTCCAGGTACAAA
 
. : . : . : . : . : . :
rJMSF050A22+ ACATTTCAAGTTTTATTATAAGCTTTGTCTAAATTTATGCAATTGTTTTATTAAGCAAGC
                      ____________________________________________________________
consensus ACATTTCAAGTTTTATTATAAGCTTTGTCTAAATTTATGCAATTGTTTTATTAAGCAAGC
 
. : . : . : . : . : . :
rJMSF050A22+ ATGCATGCATGACGATTATCGTGACCTATCAAACTCGTTGCAGAATACGGATACACGCAA
rJMSF011L03+ CAGAATACGGATACACGCAA
                      ____________________________________________________________
consensus ATGCATGCATGACGATTATCGTGACCTATCAAACTCGTTGCAGAATACGGATACACGCAA
 
. : . : . : . : . : . :
rJMSF050A22+ AAGGTGAAGGAAAAGAGTGACGTGTACAGCTTCGGGGTGGTGCTGATGGAGCTGGTGTCG
rJMSF011L03+ AAGGTGAAGGAAAAGAGTGACGTGTACAGCTTCGGGGTGGTGCTGATGGAGCTGGTGTCG
                      ____________________________________________________________
consensus AAGGTGAAGGAAAAGAGTGACGTGTACAGCTTCGGGGTGGTGCTGATGGAGCTGGTGTCG
 
. : . : . : . : . : . :
rJMSF050A22+ GGGAAGAAGCCAATCGAGGCAGAATACGGAGAGAACAACGACATTGTGAGCTGGGTGAGC
JMFS115G04- GGTGAGC
rJMSF011L03+ GGGAAGAAGCCAATCGAGGCAGAATACGGAGAGAACAACGACATTGTGAGCTGGGTGAGC
                      ____________________________________________________________
consensus GGGAAGAAGCCAATCGAGGCAGAATACGGAGAGAACAACGACATTGTGAGCTGGGTGAGC
 
. : . : . : . : . : . :
rJMSF050A22+ ACGAAGTTGAAGAGCAAAGAGAGCATATTGAGCATGGTTGATTCAGCCATCCAAGAGCCA
JMFS115G04- ACGAAGTTGAAGAGCAAAGAGAGCATATTGAGCATGGTTGATTCAGCCATCCAAGAGCCA
rJMSF011L03+ ACGAAGTTGAAGAGCAAAGAGAGCATATTGAGCATGGTTGATTCAGCCATCCAAGAGCCA
                      ____________________________________________________________
consensus ACGAAGTTGAAGAGCAAAGAGAGCATATTGAGCATGGTTGATTCAGCCATCCAAGAGCCA
 
. : . : . : . : . : . :
rJMSF050A22+ TTTAAGGAAGATGCAATTAAGGTTTTGAGGATAGCAATTTTGTGCACTGCTGCCCTCCCA
JMFS115G04- TTTAAGGAAGATGCAATTAAGGTTTTGAGGATAGCAATTTTGTGCACTGCTGCCCTCCCA
rJMSF011L03+ TTTAAGGAAGATGCAATTAAGGTTTTGAGGATAGCAATTTTGTGCACTGCTGCCCTCCCA
                      ____________________________________________________________
consensus TTTAAGGAAGATGCAATTAAGGTTTTGAGGATAGCAATTTTGTGCACTGCTGCCCTCCCA
 
. : . : . : . : . : . :
rJMSF050A22+ AATTCAAGGCCAACCATGAGGAGAGTGGTTCAAATGTTGGAGGATGCTGAGCCTTGCAAA
JMFS115G04- AATTCAAGGCCAACCATGAGGAGAGTGGTTCAAATGTTGGAGGATGCTGAGCCTTGCAAA
rJMSF011L03+ AATTCAAGGCCAACCATGAGGAGAGTGGTTCAAATGTTGGAGGATGCTGAGCCTTGCAAA
                      ____________________________________________________________
consensus AATTCAAGGCCAACCATGAGGAGAGTGGTTCAAATGTTGGAGGATGCTGAGCCTTGCAAA
 
. : . : . : . : . : . :
rJMSF050A22+ TTGGTAAGCATCATTGTCTCCAAAGATGCTGCTAAACTTGACAACCCATCAGACAACACC
JMFS115G04- TTGGTAAGCATCATTGTCTCCAAAGATGCTGCTAAACTTGACAACCCATCAGACAACACC
rJMSF011L03+ TTGGTAAGCATCATTGTCTCCAAAGATGCTGCTAAACTTGACAACCCATCAGACAACACC
                      ____________________________________________________________
consensus TTGGTAAGCATCATTGTCTCCAAAGATGCTGCTAAACTTGACAACCCATCAGACAACACC
 
. : . : . : . : . : . :
rJMSF050A22+ TCAAAGATGTAACCTTAAAACTAGTTTCTATTGGATTGTAAGCCTCTCAAGGATCATGTA
JMFS115G04- TCAAAGATGTAACCTTAAAACTAGTTTCTATTGGATTGTAAGCCTCTCAAGGATCATGTA
rJMSF011L03+ TCAAAGATGTAACCTTAAAACTAGTTTCTATTGGATTGTAAGCCTCTCAAGGATCATGTA
                      ____________________________________________________________
consensus TCAAAGATGTAACCTTAAAACTAGTTTCTATTGGATTGTAAGCCTCTCAAGGATCATGTA
 
. : . : . : . : . : . :
rJMSF050A22+ C
JMFS115G04- CAAAGGTTGTAGTGTAATATAAACATATATAATGTAACCCAAAGGGGAAGTTCAAGTGGC
rJMSF011L03+ CAAAGGTTGTAGTGTAATATAAACATATATAATGTAACCCAAAGGGGAAGTTCAAGTGGC
                      ____________________________________________________________
consensus CAAAGGTTGTAGTGTAATATAAACATATATAATGTAACCCAAAGGGGAAGTTCAAGTGGC
 
. : . : . : . : . : . :
JMFS115G04- AAACGAGCTTCTTTGTGAGGACGACCGTAGAGATAACTCGCCAAGTGACAATTCCCCTTG
rJMSF011L03+ AAACGAGCTTCTTTGTGAGGACGACCGTAGAGATAACTCGCCAAGTGACAATTCCCCTTG
                      ____________________________________________________________
consensus AAACGAGCTTCTTTGTGAGGACGACCGTAGAGATAACTCGCCAAGTGACAATTCCCCTTG
 
. : . : . : . : . : . :
JMFS115G04- GGCCAGCTTTCACGGCCCCCGTAGCGAACATGATGTATAAATCTTGATTC
rJMSF011L03+ GGCCAGCTTTCACGGCCCCCGTAGCGAACATGATGTATAAATCTTGATTCAAAAATAATG
                      ____________________________________________________________
consensus GGCCAGCTTTCACGGCCCCCGTAGCGAACATGATGTATAAATCTTGATTCAAAAATAATG