Previous Contig 011632:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011H13Sequence494011632 (4)gb:AK117417_18154524e-33Arabidopsis thaliana At2g36400 mRNA for unknown protein, complete cds, clone: RA771011632 (4)gb:AY102637_15781128e-26Arabidopsis thaliana transcription activator (GRF4) mRNA, complete cds.
JMSF012H13Sequence562011632 (4)gb:AK117417_18154521e-12Arabidopsis thaliana At2g36400 mRNA for unknown protein, complete cds, clone: RA
JMSF048P05Sequence208020459694011632 (4)gb:AK117417_18154522e-12Arabidopsis thaliana At2g36400 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011H13- GAGC
                      ____________________________________________________________
consensus GAGC
 
. : . : . : . : . : . :
JMSF011H13- TTGGGGCAGTGGCAGGAGCTTGAACTGCAGGCTTTGATCTTCAGACACATGATTGCTGGG
                      ____________________________________________________________
consensus TTGGGGCAGTGGCAGGAGCTTGAACTGCAGGCTTTGATCTTCAGACACATGATTGCTGGG
 
. : . : . : . : . : . :
JMSF011H13- GCACCTGTTCCACCTGAGCTTCTCCACCTGGTTAAAAAGAGCCTCTTCAACTCTGCTCCT
                      ____________________________________________________________
consensus GCACCTGTTCCACCTGAGCTTCTCCACCTGGTTAAAAAGAGCCTCTTCAACTCTGCTCCT
 
. : . : . : . : . : . :
JMSF011H13- TACTATTTCCCTCACCCTCTTCACCAATATCCCCATTATCACCCAGCTTCAGCACCTTTG
                      ____________________________________________________________
consensus TACTATTTCCCTCACCCTCTTCACCAATATCCCCATTATCACCCAGCTTCAGCACCTTTG
 
. : . : . : . : . : . :
JMSF011H13- ATGCAAGCAGGGTACTGGGGAGAGCGGCGATGGATCCGGAGCCGGGTCGGTGCCGGAGGA
                      ____________________________________________________________
consensus ATGCAAGCAGGGTACTGGGGAGAGCGGCGATGGATCCGGAGCCGGGTCGGTGCCGGAGGA
 
. : . : . : . : . : . :
JMSF011H13- CCGACGGGAAGAAGTGGAGGTGCTCGAGGGACGTGGTGGCGGGTCAGAAGTATTGTGAGC
rJMSF011H13+ AGAAGTGGAGGTGCTCGAGGGACGTNGTGGCGGGTCAGAAGTATTGTGAGC
                      ____________________________________________________________
consensus CCGACGGGAAGAAGTGGAGGTGCTCGAGGGACGTGGTGGCGGGTCAGAAGTATTGTGAGC
 
. : . : . : . : . : . :
JMSF011H13- GCCACATGCACCGTGGCCGCAACCGTTCAAGAAAGCCTGTGGAAATTCCCACGCCAACTC
rJMSF048P05+ TTCAAGAAAGCCTGTGGAAATTCCCACGCCAACTC
rJMSF011H13+ GCCACATGCACCGTGGCCGCAACCGTTCAAGAAAGCCTGTGGAAATTCCCACGCCAACTC
                      ____________________________________________________________
consensus GCCACATGCACCGTGGCCGCAACCGTTCAAGAAAGCCTGTGGAAATTCCCACGCCAACTC
 
. : . : . : . : . : . :
JMSF011H13- CGCCTACTGCCGCCGGTGGCCCCACGGCGGATGCTCAGCCCTTGTCCGCCGTGCCCGGCC
rJMSF048P05+ CGCCTACTGCCGCCGGTGGCCCCACGGCGGATGCTCAGCCCTTGTCCGCCGTGCCCGGCC
rJMSF011H13+ CGCCTACTGCCGCCGGTGGCCCCACGGCGGATGCTCAGCCCTTGTCCGCCGTGCCCGGCC
                      ____________________________________________________________
consensus CGCCTACTGCCGCCGGTGGCCCCACGGCGGATGCTCAGCCCTTGTCCGCCGTGCCCGGCC
 
. : . : . : . : . : . :
JMSF011H13- GTGATGCCCCCCCTCACTTCACTCTCTCCGCCGCTACTGCTCCTCCCTCGTCTTCCATTG
rJMSF048P05+ GTGATGCCCCCCCTCACTTCACTCTCTCCGCCGCTACTGTTCCTCCCTCGTCTTCCATTG
rJMSF012H13+ ACTGCTCCTCCCTCGTCTTCCATTG
rJMSF011H13+ GTGATGCCCCCCCTCACTTCACTCTCTCCGCCGCTACTGCTCCTCCCTCGTCTTCCATTG
                      ____________________________________________________________
consensus GTGATGCCCCCCCTCACTTCACTCTCTCCGCCGCTACTGCTCCTCCCTCGTCTTCCATTG
 
. : . : . : . : . : . :
JMSF011H13- ATCTCTTTCA
rJMSF048P05+ ATCTCTTTCACCTCAGTCAAAGGCATCATGGAGAGCCCATTATGGAAAGCAACGGCCCAC
rJMSF012H13+ ATCTCTTTCACCTCAGTCAAAGGCATCATGGAGAGCCCATTATGGAAAGCAACGGCCCAC
rJMSF011H13+ ATCTCTTTCACCTCAGTCAAAGGCATCATGGAGAGCCCATTATGGAAAGCAACGGCCCAC
                      ____________________________________________________________
consensus ATCTCTTTCACCTCAGTCAAAGGCATCATGGAGAGCCCATTATGGAAAGCAACGGCCCAC
 
. : . : . : . : . : . :
rJMSF048P05+ TTGAGGCCCAAAAGGATGGGCCGGCCGGCGGACAGACACTCCGGCATTTCTTCGACGACT
rJMSF012H13+ TTGAGGCCCAAAAGGATGGGCCGGCCGGCGGACAGACACTCCGGCATTTCTTCGACGACT
rJMSF011H13+ TTGAGGCCCAAAAGGATGGGCCGGCCGGCGGACAGACACTCCGGCATTTCTTCGACGACT
                      ____________________________________________________________
consensus TTGAGGCCCAAAAGGATGGGCCGGCCGGCGGACAGACACTCCGGCATTTCTTCGACGACT
 
. : . : . : . : . : . :
rJMSF048P05+ GGCCCAGACCACTTGAGGAAAATGAGAGCTCCTCCGCCGTGGCTTCCGCCACCAACCTCT
rJMSF012H13+ GGCCCAGACCACTTGAGGAAAATGAGAGCTCCTCCGCCGTGGCTTCCGCCACCAACCTCT
rJMSF011H13+ GGCCCAGACCACTTGAGGAAAATGAGAGCTCCTCCGCCGTGGCTTCCGCCACCAACCTCT
                      ____________________________________________________________
consensus GGCCCAGACCACTTGAGGAAAATGAGAGCTCCTCCGCCGTGGCTTCCGCCACCAACCTCT
 
. : . : . : . : . : . :
rJMSF048P05+ CCATATCCATCCCCGGAAACGCTTCTTCCGATTTCTCACTGAAGCTCGCCACCGGGCCTC
rJMSF012H13+ CCATATCCATCCCCGGAAACGCTTCTTCCGATTTCTCACTGAAGCTCGCCACCGGGCCTC
rJMSF011H13+ CCATATCCATCCCCGGAAACGCTTCTTCCGATTTCTCACTGAAGCTCGCCACCGGGCCTC
                      ____________________________________________________________
consensus CCATATCCATCCCCGGAAACGCTTCTTCCGATTTCTCACTGAAGCTCGCCACCGGGCCTC
 
. : . : . : . : . : . :
rJMSF048P05+ CGCTGGGGGGCAACATGGAACGGACAACCGCCGCGTGGGGGACGAGCCACCACCAGGTCC
rJMSF012H13+ CGCTGGGGGGCAACATGGAACGGACAACCGCCGCGTGGGGGACGAGCCACCACCAGGTCC
rJMSF011H13+ CGCTGGGGGGCAACATGGAACGGACAACCGCCGCGTGGGGGACGAGCCACCACCAGGTCC
                      ____________________________________________________________
consensus CGCTGGGGGGCAACATGGAACGGACAACCGCCGCGTGGGGGACGAGCCACCACCAGGTCC
 
. : . : . : . : . : . :
rJMSF048P05+ AGGTGGGTTCCGCCGTGGGCGGGCCGCTGGCGGAGGCTTTGAGATCTTCCACGTCCAACT
rJMSF012H13+ AGGTGGGTTCCGCCGTGGGCGGGCCGCTGGCGGAGGCTTTGAGATCTTCCACGTCCAACT
rJMSF011H13+ AGGTGGGTTCCGCCGTGGGCGGGCCGCTGGCGGAGGCTTTGAGATCTTCCACGTCCAACT
                      ____________________________________________________________
consensus AGGTGGGTTCCGCCGTGGGCGGGCCGCTGGCGGAGGCTTTGAGATCTTCCACGTCCAACT
 
. : . : . : . : . : . :
rJMSF048P05+ CCTCGCCCACCAGCGTTTTGCACCAGTTGCAGCGTAACTCAACAACGTCGGAGACTAGTT
rJMSF012H13+ CCTCACCCACCAGCGTTTTGCACCAGTTGCAGCGTAACTCAACAACGTCGGAGACTAGTT
rJMSF011H13+ CCTCACCCACCAGCGTTTTGCACCAGTTGCAGCGTAACTCAACAACGTCGGAGACTAGTT
                      ____________________________________________________________
consensus CCTCACCCACCAGCGTTTTGCACCAGTTGCAGCGTAACTCAACAACGTCGGAGACTAGTT
 
. : . : . : . : . : . :
rJMSF048P05+ TTATCACCAGTTGAAGAAGAAGAATCATTATATTGTTTTCTTCAAAAATGATGTATGTCT
rJMSF012H13+ TTATCACCAGTTGAAGAAGAAGAATCATTATATTGTTTTCTTCAAAAATGATGTATGTCT
rJMSF011H13+ TTATCACCAGTTGAAGAAGAAGAATCATTATATTGTTTTCTTCAAAAATGATGTATGTCT
                      ____________________________________________________________
consensus TTATCACCAGTTGAAGAAGAAGAATCATTATATTGTTTTCTTCAAAAATGATGTATGTCT
 
. : . : . : . : . : . :
rJMSF048P05+ AGGTTGTCTTATTTAAATGTCGGCTGTACAAATTGCATGCATGGAGTGTGTAATGCT
rJMSF012H13+ AGGTTGTCTTATTTAAATGTCGGCTGTACAAATTGCATGCATGGAGTGTGTAATGCT
rJMSF011H13+ AGGTTGTCTTATTTAAATGTCGGCTGTACAAATTGCATGCATGGAGTGTGTAATGCTTTA
                      ____________________________________________________________
consensus AGGTTGTCTTATTTAAATGTCGGCTGTACAAATTGCATGCATGGAGTGTGTAATGCTTTA