Previous Contig 011625:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011E20Sequence288008117 (5)pir|T01285|T012852e-14hypothetical protein At2g19370 [imported] - Arabidopsis thaliana>gb:AC003058_153803011625 (3)pir|T51468|T514681e-84hypothetical protein K10A8_120 - Arabidopsis thaliana>gb:ATK10A8_1553515 Arabido
JMSF039O20Sequence670008117 (5)pir|T51468|T514685e-21hypothetical protein K10A8_120 - Arabidopsis thaliana>gb:ATK10A8_1553515 Arabido813011625 (3)pir|T51468|T514683e-94hypothetical protein K10A8_120 - Arabidopsis thaliana>gb:ATK10A8_1553515 Arabido
JMSF052I20Sequence196008117 (5)647011625 (3)pir|T51468|T514682e-80hypothetical protein K10A8_120 - Arabidopsis thaliana>gb:ATK10A8_1553515 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039O20+ GNAACATCAAGCAGCCTATTTTCAGTTGCAAGTTTAGTCAAGATCG
rJMSF011E20+ TGCAAGTTTAGTCNAGATC-
                      ____________________________________________________________
consensus GNAACATCAAGCAGCCTATTTTCAGTTGCAAGTTTAGTCAAGATCG
 
. : . : . : . : . : . :
rJMSF039O20+ GGTACAACAGGTGGATCCGCTAAGCAACTTTTCGTCTAGTTTTGTTGATAGCTCTGATAT
rJMSF052I20+ TTTGTTGATAGCTCTGATAT
rJMSF011E20+ GGTACAACAGGTGGATCCGCTAAGCAACTTTTCGTCTAG-TTTGTTGATAGCTCTGATAT
                      ____________________________________________________________
consensus GGTACAACAGGTGGATCCGCTAAGCAACTTTTCGTCTAGTTTTGTTGATAGCTCTGATAT
 
. : . : . : . : . : . :
rJMSF039O20+ TGAAATAGAAAGGCGGGAGAGGAAGGGATGGAAGGTGAAGATACATGACCTCTCTGGCTC
rJMSF052I20+ NGAAATAGAAAGGCGGGAGAGGAAGGGATGGAAGGTGAAGATACATGACCTCTCTGGCTC
rJMSF011E20+ TGAAATAGAAAGGCGGGAGAGGAAGGGATGGAAGGTGAAGATACATGACCTCTCTGGCTC
                      ____________________________________________________________
consensus TGAAATAGAAAGGCGGGAGAGGAAGGGATGGAAGGTGAAGATACATGACCTCTCTGGCTC
 
. : . : . : . : . : . :
rJMSF039O20+ GGCTGTGGCAGCTGCGTTCATCACTACGCCATTCGTGCCATCGACCGGTTGTGATTGGGT
rJMSF052I20+ GGCTGTGGCAGCTGCGTTCATCNCTACGCCATTCGTGCCATCGACCGGTTGTGATTGGGT
rJMSF011E20+ GGCTGTGGCAGCTGCGTTCATCACTACGCCATTCGTGCCATCGACCGGTTGTGATTGGGT
                      ____________________________________________________________
consensus GGCTGTGGCAGCTGCGTTCATCACTACGCCATTCGTGCCATCGACCGGTTGTGATTGGGT
 
. : . : . : . : . : . :
rJMSF039O20+ TGACAGGTCCAACCCGGGAGCTTGGTTGATCGTACGCCCCGATCCTTGCATGCGCGAGAG
rJMSF052I20+ TGACAGGTCCAACCCGGGAGCTTGGTTGATCGTACGCCCCGATCCTTGCATGCGCGAGAG
rJMSF011E20+ TGACAGGTCCAACCCGGGAGCTTGGTTGATCGTACGCCCCGATCCTTGCATGCGCGAGAG
                      ____________________________________________________________
consensus TGACAGGTCCAACCCGGGAGCTTGGTTGATCGTACGCCCCGATCCTTGCATGCGCGAGAG
 
. : . : . : . : . : . :
rJMSF039O20+ CTGGCAACCGTGGGGGAAGCTCGAAGCATGGCGTGAACGAGGCATCAGAGACTCCATCTG
rJMSF052I20+ CTGGCAACCGTGGGGGAAGCTCGAAGCATGGCGTGAACGAGGCATCAGAGACTCCATCTG
rJMSF011E20+ CTGGCAACCGTGGGGGAAGCTCGAAGCATGGCGTGAACGAGGCATCAGAGACTCCATCTG
                      ____________________________________________________________
consensus CTGGCAACCGTGGGGGAAGCTCGAAGCATGGCGTGAACGAGGCATCAGAGACTCCATCTG
 
. : . : . : . : . : . :
rJMSF039O20+ CTGCCGCTTCCACCTCTTGTCGGATGGTCCAGAGGGGGGCGGGGATCTCCTCATGTCGGA
rJMSF052I20+ NTGCCGCTTCCACCTCTTNTCGGATGGTCCAGAGGGGGGCGGGGATCTCCTCATGTCGGA
rJMSF011E20+ CTGCCGCTTCCACCTCTTGTCGGATGGTCCAGAGGGGGGCGGGGATCTCCTCATGTCGGA
                      ____________________________________________________________
consensus CTGCCGCTTCCACCTCTTGTCGGATGGTCCAGAGGGGGGCGGGGATCTCCTCATGTCGGA
 
. : . : . : . : . : . :
rJMSF039O20+ GATCCTCATCAGCGCGGAGAAGGGCGGGGAGTTCTACATCGACACTGACAAACAGGTCCG
rJMSF052I20+ GATCCTCATCAGCGCGGAGAAGGGCGGGGAGTTNTACATCGACACTGACAAACAGGTCCG
rJMSF011E20+ GATCCTCATCAGCGCGGAGAAGGGCGGGGAGTTCTACATCGACACTGACAAACAGGTCCG
                      ____________________________________________________________
consensus GATCCTCATCAGCGCGGAGAAGGGCGGGGAGTTCTACATCGACACTGACAAACAGGTCCG
 
. : . : . : . : . : . :
rJMSF039O20+ AGCTGCAGCGAGTCCCGTGCCCAGTCCAAGAAGCAGCGGTGACTTTTCTGCGCTGAGTCC
rJMSF052I20+ AGCTGCAGCGAGTCCCGTGCCCAGTCCAAGAAGCAGCGGTGACTTTTCTGCGCTGAGTCC
rJMSF011E20+ AGCTGCAGCGAGTCCCGTGCCCAGTCCAAGAAGCAGCGGTGACTTTTCTGCGCTGAGTCC
                      ____________________________________________________________
consensus AGCTGCAGCGAGTCCCGTGCCCAGTCCAAGAAGCAGCGGTGACTTTTCTGCGCTGAGTCC
 
. : . : . : . : . : . :
rJMSF039O20+ TGTTGTGGGCGGCTTCGTCATGAGCTGTAGAGTGCAAGGCGAAGGCAAGTACAGCAAGCT
rJMSF052I20+ TGTTGTGGGCGGNTTCGTCATGAGCTGTAGAGTGCAAGGCGAAGGCAAGTACAGCAAGCT
rJMSF011E20+ TGTTGTGGGCGGCTTCGTCATGAGCTGTAGAGTGCAAGGCGAAGGCAAGTACAGCAAGCT
                      ____________________________________________________________
consensus TGTTGTGGGCGGCTTCGTCATGAGCTGTAGAGTGCAAGGCGAAGGCAAGTACAGCAAGCT
 
. : . : . : . : . : . :
rJMSF039O20+ CCTCGTGCAACTTGCCATGCGACACGTCACCTGCGTCGAGGATGCAGCCATTTTCATGGC
rJMSF052I20+ CCTCGTGCAACTTGCCATGCGACACGTCACCTGCGTCGAGGATGCAGCCATTTTCATGGC
rJMSF011E20+ CCTCGTGCAACTTGCCATGCGACACGTCACCTGCGTCGAGGATGCAGCCATTTTCATGGC
                      ____________________________________________________________
consensus CCTCGTGCAACTTGCCATGCGACACGTCACCTGCGTCGAGGATGCAGCCATTTTCATGGC
 
. : . : . : . : . : . :
rJMSF039O20+ GCTCGCTGCAGCTGTGGATCTCAGTATCGAGGCGTGCAGGCCGTTCAGAAGG-CTCAGGA
rJMSF052I20+ GCTCGCTGCAGCTGTGGATCTCAGTATCGAGGCGTGCAGGCCGTTCAGAATGNNTCAGGA
rJMSF011E20+ GCTCGCTGCAGCTGTGGATCTCAGTATCGAGGCGTGCAGGCCGTTCAGAAGG-CTCAGGA
                      ____________________________________________________________
consensus GCTCGCTGCAGCTGTGGATCTCAGTATCGAGGCGTGCAGGCCGTTCAGAAGG-CTCAGGA
 
. : . : . : . : . : . :
rJMSF039O20+ GAGGTACTCGCCATTCCTGGTGATATACATTAGTGTATAACTCTATAAATATGCATATAT
rJMSF052I20+ GAGGTACTCACCATTCCT
rJMSF011E20+ GAGGTACTCGCCATTCCTGGTGATATACATTAGTGTATAACTCTATAAATATGCATATAT
                      ____________________________________________________________
consensus GAGGTACTCGCCATTCCTGGTGATATACATTAGTGTATAACTCTATAAATATGCATATAT
 
. : . : . : . : . : . :
rJMSF039O20+ GATGTTCATGTGTTTCCAGAAACTAAGGAAACCTCCCATGTACTCTCC
rJMSF011E20+ GATGTTCATGTGTTTCCAGAAACTAAGGAAACCTCCCATGTACTCTCCTGTAACCAATGA
                      ____________________________________________________________
consensus GATGTTCATGTGTTTCCAGAAACTAAGGAAACCTCCCATGTACTCTCCTGTAACCAATGA