Previous Contig 011623:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033I24Sequence544005217 (6)gb:AY063068_15656457e-44Arabidopsis thaliana unknown protein (At1g12730) mRNA, complete cds.>gb:AF370252386011623 (3)gb:AY065088_15662424e-23Arabidopsis thaliana unknown protein (At1g63110) mRNA, complete cds.>gb:AY128722
JMFF049P01Sequence638005217 (6)gb:AY063068_15656451e-53Arabidopsis thaliana unknown protein (At1g12730) mRNA, complete cds.>gb:AF370252570011623 (3)gb:AP004096_18376683e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ17
JMSF011D17Sequence340005217 (6)gb:AY063068_15656451e-21Arabidopsis thaliana unknown protein (At1g12730) mRNA, complete cds.>gb:AF370252764011623 (3)gb:AY065088_15662424e-64Arabidopsis thaliana unknown protein (At1g63110) mRNA, complete cds.>gb:AY128722

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011D17+ TCCCCAAATATAGGNGTCTTATGGTAAGCAAAGTAACTTCCATA
                      ____________________________________________________________
consensus TCCCCAAATATAGGNGTCTTATGGTAAGCAAAGTAACTTCCATA
 
. : . : . : . : . : . :
rJMSF011D17+ GCCCATTGAATTTGAAGGAATGTGTCCAATTGTACATTTTTACTTTCAAATAACATCTTT
                      ____________________________________________________________
consensus GCCCATTGAATTTGAAGGAATGTGTCCAATTGTACATTTTTACTTTCAAATAACATCTTT
 
. : . : . : . : . : . :
rJMSF011D17+ GTGCAACTTTGACACAGGTATTTCTTTGCTGAAGTCTTTGATTTCTTCAGAAGCTTTTTT
                      ____________________________________________________________
consensus GTGCAACTTTGACACAGGTATTTCTTTGCTGAAGTCTTTGATTTCTTCAGAAGCTTTTTT
 
. : . : . : . : . : . :
rJMFF049P01+ TCATGATCCTGCCATNAGCCATGCGACTATAC
rJMSF011D17+ CTTATAGTTTTTCATGTAAACATCCTCTTCATGATCCTGCCATTAGCCATGCGACTATAC
                      ____________________________________________________________
consensus CTTATAGTTTTTCATGTAAACATCCTCTTCATGATCCTGCCATTAGCCATGCGACTATAC
 
. : . : . : . : . : . :
rJMFF049P01+ AACAGGCCCTGCTTTCTGGCTTTTGTTTACATGGCAATATGTTCAATGCTTAAATCTTAT
rJMSF011D17+ AACAGGCCCTGCTTTCTGGCTTTTGTTTACATGGCAATATGTTCAATGCTTAAATCTTAT
                      ____________________________________________________________
consensus AACAGGCCCTGCTTTCTGGCTTTTGTTTACATGGCAATATGTTCAATGCTTAAATCTTAT
 
. : . : . : . : . : . :
rJMFF049P01+ CCTTCAGTNGGAGACTCGGCTTTATACTTGGGTTTATTGGCTTTGTTTATCAACGAATTG
rJMSF011D17+ CCTTCAGTTGGAGACTCGGCTTTATACTTGGGTTTATTGGCTTTGTTTATCAACGAATTG
                      ____________________________________________________________
consensus CCTTCAGTTGGAGACTCGGCTTTATACTTGGGTTTATTGGCTTTGTTTATCAACGAATTG
 
. : . : . : . : . : . :
rJMFF049P01+ TCAGAAATGCCATTTTCTTTCTTCCTATTCTGNGGATATGTGGGTGTCTCCCTTTTAAGC
rJMFF033I24+ GAAATGCCATANTCTCTCTTCCTANTCTGNGGATATGTGGGTGTCTCCCTTTTAAGC
rJMSF011D17+ TCAGAAATGCCATTTTCTTTCTTCCTATTCTGTGGATATGTGGGTGTCTCCCTTTTAAGC
                      ____________________________________________________________
consensus TCAGAAATGCCATTTTCTTTCTTCCTATTCTGTGGATATGTGGGTGTCTCCCTTTTAAGC
 
. : . : . : . : . : . :
rJMFF049P01+ CCAGTAATGCACAACCTANGGATATGGAGGGGTACTGGAAATGCAAACTTCTATTTTGCA
rJMFF033I24+ CCAGTAANGCACAACCTATGGATATGGAGGGGTACTGGAAATGCAAACTTCTATTTTGCA
rJMSF011D17+ CCAGTAATGCACAACCTATGGATATGGAGGGGTACTGGAAATGCAAACTTCTATTTTGCA
                      ____________________________________________________________
consensus CCAGTAATGCACAACCTATGGATATGGAGGGGTACTGGAAATGCAAACTTCTATTTTGCA
 
. : . : . : . : . : . :
rJMFF049P01+ ACTGCTATGGGATACGCCTGCTTCCAGGTTATTTTGGTCGTAGAAAGTGTGAGTTCAACA
rJMFF033I24+ NCTGCTATGGGATACGCCTGCTTCCAGGTT
rJMSF011D17+ ACTGCTATGGGATACGCCTGCTTCCAGGTTATTTTGGTCGTAGAAAGTGTGAGTTCAACA
                      ____________________________________________________________
consensus ACTGCTATGGGATACGCCTGCTTCCAGGTTATTTTGGTCGTAGAAAGTGTGAGTTCAACA
 
. : . : . : . : . : . :
rJMFF049P01+ CTCAACCCTGATAGAAAAATTACAAAGTTAATTAAAACCTCAAACGCTTAAGTTTGGGCT
rJMSF011D17+ CTCAACCATGATAGAAAAATTACAAAGTTAATTAAAACCTCAAACGCTTAAGTTTGGGCT
                      ____________________________________________________________
consensus CTCAACCCTGATAGAAAAATTACAAAGTTAATTAAAACCTCAAACGCTTAAGTTTGGGCT
 
. : . : . : . : . : . :
rJMFF049P01+ TTTTGCATTATTTGTGTACTTCATATCAACATTAGTTTACAGGAAAACCATCTAGTTGCA
rJMSF011D17+ TTTTGCATTATTTGTGTACTTCATATCAACATTAGTTTACAGGAAAACCATCTAGTTGCA
                      ____________________________________________________________
consensus TTTTGCATTATTTGTGTACTTCATATCAACATTAGTTTACAGGAAAACCATCTAGTTGCA
 
. : . : . : . : . : . :
rJMFF049P01+ TTGTTGAACTTTAGTGCTGATTTAGTATCTACCTTCTAAACTTCCTTGCTTTCTTTATAA
rJMSF011D17+ TTGTTGAACTTTAGTGCTGATTTAGTATCTACCTTCTAAACTTCCTTGCTTTCTTTATAA
                      ____________________________________________________________
consensus TTGTTGAACTTTAGTGCTGATTTAGTATCTACCTTCTAAACTTCCTTGCTTTCTTTATAA
 
. : . : . : . : . : . :
rJMFF049P01+ CTTCCCTCAAATCTTTGATTTTATATTTTAATTTTTGTGATGCACTTTGGTTTTTCA
rJMSF011D17+ CTTCCCTCAAATCTTTGATTTTATATTTTAATTTTTGTGATGCACTTTGGTTTTTCATAT
                      ____________________________________________________________
consensus CTTCCCTCAAATCTTTGATTTTATATTTTAATTTTTGTGATGCACTTTGGTTTTTCATAT