Previous Contig 011619:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017G18Sequence584000895 (5)gb:AF108896_17686435e-75Capsicum annuum GTP-binding protein mRNA, complete cds.743011619 (5)gb:AF108896_1768643e-111Capsicum annuum GTP-binding protein mRNA, complete cds.
JMFF027L02Sequence553000895 (5)gb:AF108896_17686435e-69Capsicum annuum GTP-binding protein mRNA, complete cds.717011619 (5)gb:AF108896_1768643e-105Capsicum annuum GTP-binding protein mRNA, complete cds.
JMSF011C12Sequence279000895 (5)gb:AF108896_17686435e-18Capsicum annuum GTP-binding protein mRNA, complete cds.806011619 (5)gb:AF108896_17686431e-94Capsicum annuum GTP-binding protein mRNA, complete cds.
JMSF011D18Sequence353000895 (5)gb:AF108896_17686436e-33Capsicum annuum GTP-binding protein mRNA, complete cds.767011619 (5)gb:AF108896_17686431e-93Capsicum annuum GTP-binding protein mRNA, complete cds.
JMSF051I08Sequence621000895 (5)gb:AF108896_17686435e-87Capsicum annuum GTP-binding protein mRNA, complete cds.693011619 (5)pir|A86431|A864312e-86hypothetical protein T5I8.3 - Arabidopsis thaliana>gb:AE005172_891905 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027L02+ AGGTCAAAACATCTCTTGAT
rJMFF017G18+ AAAATAGAACATGAACTGTGTCTGAAGGTCAAAACATCTCTTGAT
                      ____________________________________________________________
consensus AAAATAGAACATGAACTGTGTCTGAAGGTCAAAACATCTCTTGAT
 
. : . : . : . : . : . :
rJMFF027L02+ GAGGGTAAAGATGCCCGTCTGGGGGAATGGAAAGCTGCTGACATTGAGATATTGAATACT
rJMFF017G18+ GAGGGTAAAGATGCCCGTCTGGGGGAATGGAAAGCTGCTGACATTGAGATATTGAATACT
rJMSF011D18+ GCTGCTGACATTGAGATATTGAATACT
rJMSF011C12+ GCTGCTGACA-TGAGATATNGAATACT
                      ____________________________________________________________
consensus GAGGGTAAAGATGCCCGTCTGGGGGAATGGAAAGCTGCTGACATTGAGATATTGAATACT
 
. : . : . : . : . : . :
rJMFF027L02+ TTTCAGTTGCTTACTGCAAAACCTGTTGTTTATTTGGTTAACATGAATGAGAAAGATTAT
rJMFF017G18+ TTTCAGTTGCTTACTGCAAAACCTGTTGTTTATTTGGTTAACATGAATGAGAAAGATTAT
rJMSF051I08+ TGGTTAACATGAATGAGAAAGATTAT
rJMSF011D18+ TTTCA-GTGCTTACTGCAAAACCTGTTGTTTATTTGGTTAACATGAATGAGAAAGATTAT
rJMSF011C12+ TTTCAGGTGCTTACTGCAAAACCTGTTGTTTATTTGGTTAACATGAATGAGAAAGATTAT
                      ____________________________________________________________
consensus TTTCAGTTGCTTACTGCAAAACCTGTTGTTTATTTGGTTAACATGAATGAGAAAGATTAT
 
. : . : . : . : . : . :
rJMFF027L02+ CAACGGAAAAAGAACAAGTTCCTTCCTAAGATTCATGCTTGGGTGCAAGAGCATGGTGGC
rJMFF017G18+ CAACGGAAAAAGAACAAGTTCCTTCCTAAGATTCATGCTTGGGTGCAAGAGCATGGTGGC
rJMSF051I08+ CAACGGAAAAAGAACAAGTTCCTTCCTAAGATTCATGCTTGGGTGCAAGAGCATGGTGGC
rJMSF011D18+ CAACGGAAAAAGAACAAGTTCCTTCCTAAGATTCATGCTTGGGTGCAAGAGCATGGTGGC
rJMSF011C12+ CAACGGAAAAAGAACAAGTTCCTTCCTAAGATTCATGCTTGGGTGCAAGAGCATGGTGGC
                      ____________________________________________________________
consensus CAACGGAAAAAGAACAAGTTCCTTCCTAAGATTCATGCTTGGGTGCAAGAGCATGGTGGC
 
. : . : . : . : . : . :
rJMFF027L02+ GAACTCATTATTCCTTTCAGTGCTGCTTTGGAAAGGAGTCTTGCTGATATGCCACCTGAT
rJMFF017G18+ GAACTCATTATTCCTTTCAGTGCTGCTTTGGAAAGGAGTCTTGCTGATATGCCACCTGAT
rJMSF051I08+ GAACTCATTATTCCTTTCAGTGCTGCTTTGGAAAGGAGTCTTGCTGATATGCCACCTGAT
rJMSF011D18+ GAACTCATTATTCCTTTCAGTGCTGCTTTGGAAAGGAGTCTTGCTGATATGCCACCTGAT
rJMSF011C12+ GAACTCATTATTCCTTTCAGTGCTGCTTTGGAAAGGAGTCTTGCTGATATGCCACCTGAT
                      ____________________________________________________________
consensus GAACTCATTATTCCTTTCAGTGCTGCTTTGGAAAGGAGTCTTGCTGATATGCCACCTGAT
 
. : . : . : . : . : . :
rJMFF027L02+ GAAGCTGCAAAGTATTGTGAGGAGAACAAGGTTCAAAGTGCCCTTCCAAAAATCATAAAG
rJMFF017G18+ GAAGCTGCAAAGTATTGTGAGGAGAACAAGGTTCAAAGTGCCCTTCCAAAAATCATAAAG
rJMSF051I08+ GAAGCTGCAAAGTATTGTGAGGAGAACAAGGTTCAAAGTGCCCTTCCAAAAATCATAAAG
rJMSF011D18+ GAAGCTGCAAAGTATTGTGAGGAGAACAAGGTTCAAAGTGCCCTTCCAAAAATCATAAAG
rJMSF011C12+ GAAGCTGCAAAGTATTGTGAGGAGAACAAGGTTCAAAGTGCCCTTCCAAAAATCATAAAG
                      ____________________________________________________________
consensus GAAGCTGCAAAGTATTGTGAGGAGAACAAGGTTCAAAGTGCCCTTCCAAAAATCATAAAG
 
. : . : . : . : . : . :
rJMFF027L02+ ACTGGATTTTCTGCAATTAATCTCATATATTTCTTCACAGCTGGGCCAGATGAGGTTAAA
rJMFF017G18+ ACTGGATTTTCTGCAATTAATCTCATATATTTCTTCACAGCTGGGCCAGATGAGGTTAAA
rJMSF051I08+ ACTGGATTTTCTGCAATTAATCTCATATATTTCTTCACAGCTGGGCCAGATGAGGTTAAA
rJMSF011D18+ ACTGGATTTTCTGCAATTAATCTCATATATTTCTTCACAGCTGGGCCAGATGAGGTTAAA
rJMSF011C12+ ACTGGATTTTCTGCAATTAATCTCATATATTTCTTCACAGCTGGGCCAGATGAGGTTAAA
                      ____________________________________________________________
consensus ACTGGATTTTCTGCAATTAATCTCATATATTTCTTCACAGCTGGGCCAGATGAGGTTAAA
 
. : . : . : . : . : . :
rJMFF027L02+ TGCTGGCAAATTCGCCGCCAGACAAAGGCTCCTCAAGCTGCAGGAGCAATTCATACTGAT
rJMFF017G18+ TGCTGGCAAATTCGCCGCCAGACAAAGGCTCCTCAAGCTGCAGGAGCAATTCATACTGAT
rJMSF051I08+ TGCTGGCAAATTCGCCGCCAGACAAAGGCTCCTCAAGCTGCAGGAGCAATTCATACTGAT
rJMSF011D18+ TGCTGGCAAATTCGCCGCCAGACAAAGGCTCCTCAAGCTGCAGGAGCAATTCATACTGAT
rJMSF011C12+ TGCTGGCAAATTCGCCGCCAGACAAAGGCTCCTCAAGCTGCAGGAGCAATTCATACTGAT
                      ____________________________________________________________
consensus TGCTGGCAAATTCGCCGCCAGACAAAGGCTCCTCAAGCTGCAGGAGCAATTCATACTGAT
 
. : . : . : . : . : . :
rJMFF027L02+ TTAGAGAGAGGATTCATTTGTGCTGAGGTCATGAAATTTGAAGATCTAAAGGAACTTGGT
rJMFF017G18+ TTAGAGAGAGGATTCATTTGTGCTGAGGTCATGAAATTTGAAGATCTAAAGGAACTTGGT
rJMSF051I08+ TTTGAGAGAGGATTCATTTGTGCTGAGGTCATGAAATTTGAAGATCTAAAGGAACTTGGT
rJMSF011D18+ TTTGAGAGAGGATTCATTTGTGCTGAGGTCATGAAATTTGAAGATCTAAAGGAACTTGGT
rJMSF011C12+ TTTGAGAGAGGATTCATTTGTGCTGAGGTCATGAAATTTGAAGATCTAAAGGAACTTGGT
                      ____________________________________________________________
consensus TTTGAGAGAGGATTCATTTGTGCTGAGGTCATGAAATTTGAAGATCTAAAGGAACTTGGT
 
. : . : . : . : . : . :
rJMFF027L02+ AGTGAGCCTGCTGTTAAGGCTGGTGGAAAGTATAGGCAGGAGGGAAAGACATATGTGGTC
rJMFF017G18+ AGTGAGCCTGCTGTTAAGGCTGGTGGAAAGTATAGGCAGGAGGGAAAGACATATGTGGTC
rJMSF051I08+ AGTGAGCCTGCTGTTAAGGCTGGTGGAAAGTATAGGCAGGAGGGAAAGACATATGTGGTC
rJMSF011D18+ AGTGAGCCTGCTGTTAAGGCTGGTGGAAAGTATAGGCAGGAGGGAAAGACATATGTGGTC
rJMSF011C12+ AGTGAGCCTGCTGTTAAGGCTGGTGGAAAGTATAGGCAGGAGGGAAAGACATATGTGGTC
                      ____________________________________________________________
consensus AGTGAGCCTGCTGTTAAGGCTGGTGGAAAGTATAGGCAGGAGGGAAAGACATATGTGGTC
 
. : . : . : . : . : . :
rJMFF027L02+ CAAGATGGAGATGTAATATTCTTCAAGTTCAATGTTTCCGGGGGAGGGAAGAAGTAAGTT
rJMFF017G18+ CAAGATGGAGATGTAATATTCTTCAAGTTCAATGTTTCCGGGGGAGGGAAGAAGTAAGTT
rJMSF051I08+ CAAGATGGAGATGTAATATTCTTCAAGTTCAATGTTTCCGGGGGAGGGAAGAAGTAAGTT
rJMSF011D18+ CAAGATGGAGATGTAATATTCTTCAAGTTCAATGTTTCCGGGGGAGGGAAGAAGTAAGTT
rJMSF011C12+ CAAGATGGAGATGTAATATTCTTCAAGTTCAATGTTTCCGGGGGAGGGAAGAAGTAAGTT
                      ____________________________________________________________
consensus CAAGATGGAGATGTAATATTCTTCAAGTTCAATGTTTCCGGGGGAGGGAAGAAGTAAGTT
 
. : . : . : . : . : . :
rJMFF027L02+ CTATCTGCACTCGTTTACTTATAAGACAGTACTATTTTGTTCGTTGAGTGAAGAAGTGAT
rJMFF017G18+ CTATCTGCACTCGTTTACTTATAAGACAGTACTATTTTGTTCGTTGAGTGAAGAAGTGAT
rJMSF051I08+ CTATCTGCACTCGTTTACTTATAAGACAGTACTATTTTGTTCGTTGAGTGAAGAAGTGAT
rJMSF011D18+ CTATCTGCACTCGTTTACTTATAAGACAGTACTATTTTGTTCGTTGAGTGAAGAAGTGAT
rJMSF011C12+ CTATCTGCACTCGTTTACTTATAAGACAGTACTATTTTGTTCGATGAGTGAAGAAGTGAT
                      ____________________________________________________________
consensus CTATCTGCACTCGTTTACTTATAAGACAGTACTATTTTGTTCGTTGAGTGAAGAAGTGAT
 
. : . : . : . : . : . :
rJMFF027L02+ ATTTGTATCTTCAACAAGCCTTGAGGCAGCAGATTCA
rJMFF017G18+ ATTTGTATCTTCAACAAGCCTTGAGGCAGCAGATTCAA
rJMSF051I08+ ATTTGTATCTTCAACAAGCCTTGAGGCAGCAGATTCAATGATTTAATACTTTTTGTTCAG
rJMSF011D18+ ATTTGTATCTTCAACAAGCCTTGAGGCAGCAGATTCAATGATTTAATACTTTTTGTTCAG
rJMSF011C12+ ATTTGTATCTTCAACAAGCCTTGAGGCAGCAGATTCAATGATTTAATACTTTTTGTTCAG
                      ____________________________________________________________
consensus ATTTGTATCTTCAACAAGCCTTGAGGCAGCAGATTCAATGATTTAATACTTTTTGTTCAG
 
. : . : . : . : . : . :
rJMSF051I08+ TATTAGCAGTGGAAGCCTTTAGATATGTTCCCTACTTTCACACTTCCTCTACTGTTATGG
rJMSF011D18+ TATTAGCAGTGGAAGCCTTTAGATATGTTCCCTACTTTCACACTTCCTCTACTGTTATGG
rJMSF011C12+ TATTAGCAGTGGAAGCCTTTAGATATGTTCCCTACTTTCACACTTCCTCTACTGTTATGG
                      ____________________________________________________________
consensus TATTAGCAGTGGAAGCCTTTAGATATGTTCCCTACTTTCACACTTCCTCTACTGTTATGG
 
. : . : . : . : . : . :
rJMSF051I08+ GGATTTT
rJMSF011D18+ GGATTTTTGGGTCTCCTT
rJMSF011C12+ GGATTTTTGGGTCTCCTTTGATTGTTATACTAACTTGATAGTGAGATTTTCGCTATGATC
                      ____________________________________________________________
consensus GGATTTTTGGGTCTCCTTTGATTGTTATACTAACTTGATAGTGAGATTTTCGCTATGATC