Previous Contig 011616:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003H13Sequence402011616 (8)pir|S53127|S531275e-41asparaginase (EC 3.5.1.1) - Arabidopsis thaliana>gb:ATASPAG_1544089 A.thaliana (711011616 (8)pir|S22523|S225233e-79asparaginase (EC 3.5.1.1) [validated] - tree lupine (fragment)
JMSF011C03Sequence354011616 (8)pir|S53127|S531272e-32asparaginase (EC 3.5.1.1) - Arabidopsis thaliana>gb:ATASPAG_1544089 A.thaliana (727011616 (8)pir|S22523|S225237e-71asparaginase (EC 3.5.1.1) [validated] - tree lupine (fragment)
JMSF016M07Sequence424011616 (8)sp|P50287|ASPG_ARATH5e-45L-asparaginase (EC 3.5.1.1) (L-asparagine amidohydrolase).>pir|T50495|T50495 asp776011616 (8)pir|S22523|S225231e-89asparaginase (EC 3.5.1.1) [validated] - tree lupine (fragment)
JMSF038G14Sequence636011616 (8)sp|P50287|ASPG_ARATH1e-72L-asparaginase (EC 3.5.1.1) (L-asparagine amidohydrolase).>pir|T50495|T50495 asp949011616 (8)sp|Q9ZSD6|ASPG_LUPLUe-115L-asparaginase (EC 3.5.1.1) (L-asparagine amidohydrolase).>gb:AF112444_1769091 L

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011C03- GAGAGGTGTCTACTATGGGTTGGGCTATCGC
JMSF016M07- GGTGTCTACTATGGGTTGGGCTATCGC
JMFF003H13- GGTGTCTACTATGGGTTGGGCTATCGC
JMSF038G14- GGTGTCTACTATGGGTTGGGCTATCGC
                      ____________________________________________________________
consensus GAGAGGTGTCTACTATGGGTTGGGCTATCGC
 
. : . : . : . : . : . :
JMSF011C03- TTTGCACGGTGGCGCCGGTGACATTCCCCGGGATCTCCCTCAACAACGCCGCCAGCCCAG
JMSF016M07- TTTGCACGGTGGCGCCGGTGACATTCCCCGGGATCTCCCTCAACAACGCCGCCAGCCCAG
JMFF003H13- TTTGCACGGTGGCGCCGGTGACATTCCCCGGGATCTCCCTCAACAACGCCGCCAGCCCAG
JMSF038G14- TTTGCACGGTGGCGCCGGTGACATTCCCCGGGATCTCCCTCAACAACGCCGCCAGCCCAG
                      ____________________________________________________________
consensus TTTGCACGGTGGCGCCGGTGACATTCCCCGGGATCTCCCTCAACAACGCCGCCAGCCCAG
 
. : . : . : . : . : . :
JMSF011C03- AGAGGCCGCCCTCCGCCACTGCTTAGAGATCGGCGTCGCCGCCATCAAGGCCAACAAATC
JMSF016M07- AGAGGCCGCCCTCCGCCACTGCTTAGAGATCGGCGTCGCCGCCATCAAGGCCAACAAATC
JMFF003H13- AGAGGCCGCCCTCCGCCACTGCTTAGAGATCGGCGTCGCCGCCATCAAGGCCAACAAATC
JMSF038G14- AGAGGCCGCCCTCCGCCACTGCTTAGAGATCGGCGTCGCCGCCATCAAGGCCAACAAATC
                      ____________________________________________________________
consensus AGAGGCCGCCCTCCGCCACTGCTTAGAGATCGGCGTCGCCGCCATCAAGGCCAACAAATC
 
. : . : . : . : . : . :
JMSF011C03- CCCCTTGGATGTCGTTGAACTCGTGGTTCGCGAACTGGAAAATATTCCATGCTTTAATGC
JMSF016M07- CCCCTTGGATGTCGTTGAACTCGTGGTTCGCGAACTGGAAAATATTCCATGCTTTAATGC
JMFF003H13- CCCCTTGGATGTCGTTGAACTCGTGGTTCGCGAACTGGAAAATATTCCATGCTTTAATGC
JMSF038G14- CCCCTTGGATGTCGTTGAACTCGTGGTTCGCGAACTGGAAAATATTCCATGCTTTAATGC
rJMSF038G14+ ATGTCGTTGAACTCGTGGTTCGCGAACTGGAAAATATTCCATGCTTTAATGC
                      ____________________________________________________________
consensus CCCCTTGGATGTCGTTGAACTCGTGGTTCGCGAACTGGAAAATATTCCATGCTTTAATGC
 
. : . : . : . : . : . :
JMSF011C03- CGGTAGAGGTTCTGTTTTGACAAACAGCGGGACCGTTGAAATGGAAGCTTCCATCATGGA
JMSF016M07- CGGTAGAGGTTCTGTTTTGACAAACAGCGGGACCGTTGAAATGGAAGCTTCCATCATGGA
JMFF003H13- CGGTAGAGGTTCTGTTTTGACAAACAGCGGGACCGTTGAAATGGAAGCTTCCATCATGGA
JMSF038G14- CGGTAGAGGTTCTGTTTTGACAAACAGCGGGACCGTTGAAATGGAAGCTTCCATCATGGA
rJMSF038G14+ CGGTAGAGGTTCTGTTTTGACAAACAGCGGGACCGTTGAAATGGAAGCTTCCATCATGGA
                      ____________________________________________________________
consensus CGGTAGAGGTTCTGTTTTGACAAACAGCGGGACCGTTGAAATGGAAGCTTCCATCATGGA
 
. : . : . : . : . : . :
JMSF011C03- TGGCAATACGAAGAGGTGCGGTGCTGTTTCCGGTCTCACTACAGTTGTCAATGCCGTGTC
JMSF016M07- TGGCAATACGAAGAGGTGCGGTGCTGTTTCCGGTCTCACTACAGTTGTCAATGCCGTGTC
JMFF003H13- TGGCAATACGAAGAGGTGCGGTGCTGTTTCCGGTCTCACTACAGTTGTCAATGCCGTGTC
JMSF038G14- TGGCAATACGAAGAGGTGCGGTGCTGTTTCCGGTCTCACTACAGTTGTCAATGCCGTGTC
rJMSF038G14+ TGGCAATACGAAGAGGTGCGGTGCTGTTTCCGGTCTCACTACAGTTGTCAATGCCGTGTC
                      ____________________________________________________________
consensus TGGCAATACGAAGAGGTGCGGTGCTGTTTCCGGTCTCACTACAGTTGTCAATGCCGTGTC
 
. : . : . : . : . : . :
JMSF011C03- TCTAGCAAGGCTGGTCATGGAGA
JMSF016M07- TCTAGCAAGGCTGGTCATGGAGAAGACTCCGCATATATATCTTGCTTTCGAGGGGGCCGA
JMFF003H13- TCTAGCAAGGCTGGTCATGGAGAAGACTCCGCATATATATCTTGCTTTCGAGGGGGCCGA
JMSF038G14- TCTAGCAAGGCTGGTCATGGAGAAGACTCCGCATATATATCTTGCTTTCGAGGGGGCCGA
rJMSF038G14+ TCTAGCAAGGCTGGTCATGGAGAAGACTCCGCATATATATCTTGCTTTCGAGGGGGCCGA
rJMSF016M07+ CTAGCAAGGCTGGTCATGGAGAAGACTCCGCATATATATCTTGCTTTCGAGGGGGCCGA
                      ____________________________________________________________
consensus TCTAGCAAGGCTGGTCATGGAGAAGACTCCGCATATATATCTTGCTTTCGAGGGGGCCGA
 
. : . : . : . : . : . :
JMSF016M07- GGCATTTGCAAGGGAACAGGGTGTTGAAACTGTGGAT
JMFF003H13- GGCATTTGCAAG
JMSF038G14- GGCATTTGCAAGGGAACAGGGTGTTGAAACTGTGGATACTAGCCATTTCATCACTCCCGA
rJMSF038G14+ GGCATTTGCAAGGGAACAGGGTGTTGAAACTGTGGATACTAGCCATTTCATCACTCCCGA
rJMFF003H13+ TTTGCAAGGGAACAGGGTGTTGAAACTGTGGATACTAGCCATTTCATCACTCCCGA
rJMSF016M07+ GGCATTTGCAAGGGAACAGGGTGTTGAAACTGTGGATACTAGCCATTTCATCACTCCCGA
rJMSF011C03+ CACTCCCGA
                      ____________________________________________________________
consensus GGCATTTGCAAGGGAACAGGGTGTTGAAACTGTGGATACTAGCCATTTCATCACTCCCGA
 
. : . : . : . : . : . :
JMSF038G14- GAATATTGAGAGGCTAAAGCAAGCAAAAGAAGCAAACCGAGTTCAGATCGATTATACACA
rJMSF038G14+ GAATATTGAGAGGCTAAAGCAAGCAAAAGAAGCAAACCGAGTTCAGATCGATTATACACA
rJMFF003H13+ GAATATTGAGAGGCTAAAGCAAGCAAAAGAAGCAAACCGAGTTCAGATCGATTATACACA
rJMSF016M07+ GAATATTGAGAGGCTAAAGCAAGCAAAAGAAGCAAACCGAGTTCAGATCGATTATACACA
rJMSF011C03+ GAATATTGAGAGGCTAAAGCAAGCAAAAGAAGCAAACCGAGTTCAGATCGATTATACACA
                      ____________________________________________________________
consensus GAATATTGAGAGGCTAAAGCAAGCAAAAGAAGCAAACCGAGTTCAGATCGATTATACACA
 
. : . : . : . : . : . :
JMSF038G14- ACCCATGCCTAAAGTTGAGAAAGAAGAAACGATTCCTAATGGGGATAGCCAAATTGGAAC
rJMSF038G14+ ACCCATGCCTAAAGTTGAGAAAGAAGAAACGATTCCTAATGGGGATAGCCAAATTGGAAC
rJMFF003H13+ ACCCATGCCTAAAGTTGAGAAAGAAGAAACGATTCCTAATGGGGATAGCCAAATTGGAAC
rJMSF016M07+ ACCCATGCCTAAAGTTGAGAAAGAAGAAACGATTCCTAATGGGGATAGCCAAATTGGAAC
rJMSF011C03+ ACCCATGCCTAAAGTTGAGAAAGAAGAAACGATTCCTAATGGGGATAGCCAAATTGGAAC
                      ____________________________________________________________
consensus ACCCATGCCTAAAGTTGAGAAAGAAGAAACGATTCCTAATGGGGATAGCCAAATTGGAAC
 
. : . : . : . : . : . :
JMSF038G14- AGTTGGATGTGTAGCCGTTGATGGTAATGGTAATTTGGCTACTGCGACTTCTACTGGTGG
rJMSF038G14+ AGTTGGATGTGTAGCCGTTGATGGTAATGGTAATTTGGCTACTGCGACTTCTACTGGTGG
rJMFF003H13+ AGTTGGATGTGTAGCCGTTGATGGTAATGGTAATTTGGCTACTGCGACTTCTACTGGTGG
rJMSF016M07+ AGTTGGATGTGTAGCCGTTGATGGTAATGGTAATTTGGCTACTGCGACTTCTACTGGTGG
rJMSF011C03+ AGTTGGATGTGTAGCCGTTGATGGTAATGGTAATTTGGCTACTGCGACTTCTACTGGTGG
                      ____________________________________________________________
consensus AGTTGGATGTGTAGCCGTTGATGGTAATGGTAATTTGGCTACTGCGACTTCTACTGGTGG
 
. : . : . : . : . : . :
JMSF038G14- ATTAG
rJMSF038G14+ ATTAGTGAACAAGATGGTGGGAAGGATAGGTGACACACCCGTTATCGGTGCTGGGACATA
rJMFF003H13+ ATTAGTGAACAAGATGGTGGGAAGGATAGGTGACACACCCGTTATCGGTGCTGGGACATA
rJMSF016M07+ ATTAGTGAACAAGATGGTGGGAAGGATAGGTGACACACCCGTTATCGGTGCTGGGACATA
rJMSF011C03+ ATTAGTGAACAAGATGGTGGGAAGGATAGGTGACACACCCGTTATCGGTGCTGGGACATA
                      ____________________________________________________________
consensus ATTAGTGAACAAGATGGTGGGAAGGATAGGTGACACACCCGTTATCGGTGCTGGGACATA
 
. : . : . : . : . : . :
rJMSF038G14+ TGCCAATCGATTCTGTGCAGTTTCTGCAACCGGTAAAGGGGAAGCAATTATCCGTGCTAC
rJMFF003H13+ TGCCAATCGATTCTGTGCAGTTTCTGCAACCGGTAAAGGGGAAGCAATTATCCGTGCTAC
rJMSF016M07+ TGCCAATCGATTCTGTGCAGTTTCTGCAACCGGTAAAGGGGAAGCAATTATCCGTGCTAC
rJMSF011C03+ TGCCAATCGATTCTGTGCAGTTTCTGCAACCGGTAAAGGGGAAGCAATTATCCGTGCTAC
                      ____________________________________________________________
consensus TGCCAATCGATTCTGTGCAGTTTCTGCAACCGGTAAAGGGGAAGCAATTATCCGTGCTAC
 
. : . : . : . : . : . :
rJMSF038G14+ TGTAGCGAGAGATGTAGCCGCTCTGATGGAGTACAAAGGGATTTCTCTCGAGGAGGCAGC
rJMFF003H13+ TGTAGCGAGAGATGTAGCCGCTCTGATGGAGTACAAAGGGATTTCTCTCGAGGAGGCAGC
rJMSF016M07+ TGTAGCGAGAGATGTAGCCGCTCTGATGGAGTACAAAGGGATTTCTCTCGAGGAGGCAGC
rJMSF011C03+ TGTAGCGAGAGATGTAGCCGCTCTGATGGAGTACAAAGGGATTTCTCTCGAGGAGGCAGC
                      ____________________________________________________________
consensus TGTAGCGAGAGATGTAGCCGCTCTGATGGAGTACAAAGGGATTTCTCTCGAGGAGGCAGC
 
. : . : . : . : . : . :
rJMSF038G14+ CGATTACGTCATACAGGAGTGCGCTCCGAAGGGCACTGCAGGTCTGGTCGCGGTTTCTGC
rJMFF003H13+ CGATTACGTCATACAGGAGTGCGCTCCGAAGGGCACTGCAGGTCTGGTCGCGGTTTCTGC
rJMSF016M07+ CGATTACGTCATACAGGAGTGCGCTCCGAAGGGCACTGCAGGTCTGGTCGCGGTTTCTGC
rJMSF011C03+ CGATTACGTCATACAGGAGTGCGCTCCGAAGGGCACTGCAGGTCTGGTCGCGGTTTCTGC
                      ____________________________________________________________
consensus CGATTACGTCATACAGGAGTGCGCTCCGAAGGGCACTGCAGGTCTGGTCGCGGTTTCTGC
 
. : . : . : . : . : . :
rJMSF038G14+ CACTGGAGAGGTCACGATGCCATTTAACACAACCGGAATGTTTAGAGCTTGTGCAACCGA
rJMFF003H13+ CACTGGAGAGGTCACGATGCCATTTAACACAACCGGAATGTTTAGAGCTTGTGCAACCGA
rJMSF016M07+ CACTGGAGAGGTCACGATGCCATTTAACACAACCGGAATGTTTAGAGCTTGTGCAACCGA
rJMSF011C03+ CACTGGAGAGGTCACGATGCCATTTAACACAACCGGAATGTTTAGAGCTTGTGCAACCGA
                      ____________________________________________________________
consensus CACTGGAGAGGTCACGATGCCATTTAACACAACCGGAATGTTTAGAGCTTGTGCAACCGA
 
. : . : . : . : . : . :
rJMSF038G14+ GGATGGTCATCGCGAAGTTGAAATTTGGTAATCATGCATTATTCCTAGTAGAACTTTGTT
rJMFF003H13+ GGATGGTCATCGCGAAGTTGAAATTTGGTAATCATGCATTATTCCTAGTAGAACTTTGTT
rJMSF016M07+ GGATGGTCATCGCGAAGTTGAAATTTGGTAATCATGCATTATTCCTAGTAGAACTTTGTT
rJMSF011C03+ GGATGGTCATCGCGAAGTTGAAATTTGGTAATCATGCATTATTCCTAGTAGAACTTTGTT
                      ____________________________________________________________
consensus GGATGGTCATCGCGAAGTTGAAATTTGGTAATCATGCATTATTCCTAGTAGAACTTTGTT
 
. : . : . : . : . : . :
rJMSF038G14+ TCTTCATTTATGTTTAGATCCCCGGGACATCTTGTGATATCTGTTCTGCATTATCTTTTA
rJMFF003H13+ TCTTCATTTATGTTTAGATCCCCGGGACATCTTGTGATATCTGTTCTGCATTATCTTTTA
rJMSF016M07+ TCTTCATTTATGTTTAGATCCCCGGGACATCTTGTGATATCTGTTCTGCATTATCTTTTA
rJMSF011C03+ TCTTCATTTATGTTTAGATCCCCGGGACATCTTGTGA--TCTGTTCTGCATTATCTTTTA
                      ____________________________________________________________
consensus TCTTCATTTATGTTTAGATCCCCGGGACATCTTGTGATATCTGTTCTGCATTATCTTTTA
 
. : . : . : . : . : . :
rJMSF038G14+ TTCTTGGCTGGGAGTCATAACTCATAATTTTCATTTTTACTCTATGCTCAGAAGA
rJMFF003H13+ TTCTTGGCTGGGAGTCATAACTCATAATTTTCATTTTTACTCTATGCTCAGAAGA
rJMSF016M07+ TTCTTGGCTGGGAGTCATAACTCATAATTTTCATTTTTACTCTATGCTCAGAAGA
rJMSF011C03+ TTCTTGGCTGGGAGTCATAACTCATAATTTTCATTTTTACTCTATGCTCAGAAGATATTA
                      ____________________________________________________________
consensus TTCTTGGCTGGGAGTCATAACTCATAATTTTCATTTTTACTCTATGCTCAGAAGATATTA
 
. : . : . : . : . : . :
rJMSF011C03+ GTCTAGTTCAGAAGTTAAGATAGTCAAAATTTGAGGCATCTTTGTTGGTCATCNTCCTTA
                      ____________________________________________________________
consensus GTCTAGTTCAGAAGTTAAGATAGTCAAAATTTGAGGCATCTTTGTTGGTCATCNTCCTTA