Previous Contig 011611:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011B17Sequence245011611 (2)gb:AE016959_10232911e-10Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07687011611 (2)gb:AE016959_10232911e-14Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011B17- GAATGGGAATCAAGGGTTTTATCCTAT
rJMSF011B17+ GAATGGGAATCAAGGGTTTTATCCTAT
                      ____________________________________________________________
consensus GAATGGGAATCAAGGGTTTTATCCTAT
 
. : . : . : . : . : . :
JMSF011B17- GATTTTCGTGTTCCAGACCACTTGATTGAAGCCTACTGCAGAAAAGGTCTGCTGGGGAAA
rJMSF011B17+ GATTTTCGTGTTCCAGACCACTTGATTGAAGCCTACTGCAGAAAAGGTCTGCTGGGGAAA
                      ____________________________________________________________
consensus GATTTTCGTGTTCCAGACCACTTGATTGAAGCCTACTGCAGAAAAGGTCTGCTGGGGAAA
 
. : . : . : . : . : . :
JMSF011B17- GCTGAAGCAGTTTTAGAACGAGGAATAGCTAAAGGCGGGGTCCCTTCAGCTGCTACATGG
rJMSF011B17+ GCTGAAGCAGTTTTAGAACGAGGAATAGCTAAAGGCGGGGTCCCTTCAGCTGCTACATGG
                      ____________________________________________________________
consensus GCTGAAGCAGTTTTAGAACGAGGAATAGCTAAAGGCGGGGTCCCTTCAGCTGCTACATGG
 
. : . : . : . : . : . :
JMSF011B17- TGTTACATGGCAGGCGGGTATCTCCTGGATGGCCAAGAACCGAAAGCTCTGGAAGCTTTG
rJMSF011B17+ TGTTACATGGCAGGCGGGTATCTCCTGGATGGCCAAGAACCGAAAGCTCTGGAAGCTTTG
                      ____________________________________________________________
consensus TGTTACATGGCAGGCGGGTATCTCCTGGATGGCCAAGAACCGAAAGCTCTGGAAGCTTTG
 
. : . : . : . : . : . :
JMSF011B17- AATAAAGCCGTATCCATATGTCCACCCGATTTTAATCC
rJMSF011B17+ AATAAAGCCGTATCCATATGTCCACCCGATTTTAATCCTAGTAAGGATACCCTGATTAAA
                      ____________________________________________________________
consensus AATAAAGCCGTATCCATATGTCCACCCGATTTTAATCCTAGTAAGGATACCCTGATTAAA
 
. : . : . : . : . : . :
rJMSF011B17+ TGTGTGGAATATCTTGAAAAGCATGGCAATGTGGAGAATGCTGAGGAGTTGATACAATCT
                      ____________________________________________________________
consensus TGTGTGGAATATCTTGAAAAGCATGGCAATGTGGAGAATGCTGAGGAGTTGATACAATCT
 
. : . : . : . : . : . :
rJMSF011B17+ TTAGAAGATATACGAGCTTTCTCACCAATCTTACGTGAAAAACTATCTTGTTTGATTAAG
                      ____________________________________________________________
consensus TTAGAAGATATACGAGCTTTCTCACCAATCTTACGTGAAAAACTATCTTGTTTGATTAAG
 
. : . : . : . : . : . :
rJMSF011B17+ GATCCATCCATAGCTGAGGCAGAGCAAGGTGGTGCCTAGGTGATATGATCTTGGATTGTC
                      ____________________________________________________________
consensus GATCCATCCATAGCTGAGGCAGAGCAAGGTGGTGCCTAGGTGATATGATCTTGGATTGTC
 
. : . : . : . : . : . :
rJMSF011B17+ ACGAGACAACAGCTTGGCAAGGTCAATGATGTTTCTTGAGAGTACACCATGGGTATCATG
                      ____________________________________________________________
consensus ACGAGACAACAGCTTGGCAAGGTCAATGATGTTTCTTGAGAGTACACCATGGGTATCATG
 
. : . : . : . : . : . :
rJMSF011B17+ ATTATTTGATAGTTAACGTTAACATACTTTTTCTTTTTTTGTGTACTCAAGGTTTTCACT
                      ____________________________________________________________
consensus ATTATTTGATAGTTAACGTTAACATACTTTTTCTTTTTTTGTGTACTCAAGGTTTTCACT
 
. : . : . : . : . : . :
rJMSF011B17+ GTCAGACACAGTGACTAATCTCCTTGCTGATTGTATCTATCACTGCTTTTATTAGATTTT
                      ____________________________________________________________
consensus GTCAGACACAGTGACTAATCTCCTTGCTGATTGTATCTATCACTGCTTTTATTAGATTTT
 
. : . : . : . : . : . :
rJMSF011B17+ AGATTGGACCCCTGACCATTCTCCAGGGGCATTTGGTTTGTGGAGAGTTGTGGGGTGGTT
                      ____________________________________________________________
consensus AGATTGGACCCCTGACCATTCTCCAGGGGCATTTGGTTTGTGGAGAGTTGTGGGGTGGTT