Previous Contig 011610:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011A18Sequence262005202 (2)758011610 (2)pir|C71411|C714116e-90hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV40_1545284 Arabidopsis tha
JMSF017M20Sequence423005202 (2)gb:AB026657_15173413e-06Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXO21.794011610 (2)pir|C71411|C714119e-92hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV40_1545284 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017M20+ ATGCTGGACTGGTT
                      ____________________________________________________________
consensus ATGCTGGACTGGTT
 
. : . : . : . : . : . :
rJMSF017M20+ GAAGAAGGGNCAAAAAATGTTTTCATCCATNGTGAATGAATATGGACTGGTGCCAAAACA
rJMSF011A18+ GTGAATGAATATGGACTGGTGCCAAAACA
                      ____________________________________________________________
consensus GAAGAAGGGNCAAAAAATGTTTTCATCCATNGTGAATGAATATGGACTGGTGCCAAAACA
 
. : . : . : . : . : . :
rJMSF017M20+ TGAACACTACGGTTGCATGGTAGACCTCTATGGCCGTGCAAACCTTCTTAAAGAAGCCCT
rJMSF011A18+ TGAACACTACGGTTGCATGGTAGACCTCTATGGCCGTGCAAACCTTCTTAAAGAAGCCCT
                      ____________________________________________________________
consensus TGAACACTACGGTTGCATGGTAGACCTCTATGGCCGTGCAAACCTTCTTAAAGAAGCCCT
 
. : . : . : . : . : . :
rJMSF017M20+ TAAGGTTATAGAGACTATGCCAATGGCCCCAAATGTAGTCATCTGGGGCTCCTTAATGGC
rJMSF011A18+ TAAGGTTATAGAGACTATGCCAATGGCCCCAAATGTAGTCATCTGGGGCTCCTTAATGGC
                      ____________________________________________________________
consensus TAAGGTTATAGAGACTATGCCAATGGCCCCAAATGTAGTCATCTGGGGCTCCTTAATGGC
 
. : . : . : . : . : . :
rJMSF017M20+ AGCCTGTCGGATCCATGGTGAGTTTGAGTTAGGAGAATTTGCTGCAAAACAGATTCTTGT
rJMSF011A18+ AGCCTGTCGGATCCATGGTGAGTTTGAGTTAGGAGAATTTGCTGCAAAACAGATTCTTGT
                      ____________________________________________________________
consensus AGCCTGTCGGATCCATGGTGAGTTTGAGTTAGGAGAATTTGCTGCAAAACAGATTCTTGT
 
. : . : . : . : . : . :
rJMSF017M20+ GTTAGAACCAGACCACAGTGGTGCCCATGTTTTATTATCGAACATTTATGCCAAAGAAAG
rJMSF011A18+ GTTAGAACCAGACCACAGTGGTGCCCATGTTTTATTATCGAACATTTATGCCAAAGAAAG
                      ____________________________________________________________
consensus GTTAGAACCAGACCACAGTGGTGCCCATGTTTTATTATCGAACATTTATGCCAAAGAAAG
 
. : . : . : . : . : . :
rJMSF017M20+ GAGATGGGGAAATGTTAGAGAGGTGAGAAAATTGATGACACTCAATGACATATCGAAGGA
rJMSF011A18+ GAGATGGGGAAATGTTAGAGAGGTGAGAAAATTGATGACACTCAATGACATATCGAAGGA
                      ____________________________________________________________
consensus GAGATGGGGAAATGTTAGAGAGGTGAGAAAATTGATGACACTCAATGACATATCGAAGGA
 
. : . : . : . : . : . :
rJMSF017M20+ ACAGGGCTGCAGCAAGATCGAAATCAACCAGGAGATCCATGAATTTTTGACGGCAGACAG
rJMSF011A18+ ACAGGGCTGCAGCAAGATCGAAATCAACCAGGAGATCCATGAATTTTTGACGGCAGACAG
                      ____________________________________________________________
consensus ACAGGGCTGCAGCAAGATCGAAATCAACCAGGAGATCCATGAATTTTTGACGGCAGACAG
 
. : . : . : . : . : . :
rJMSF017M20+ AAGTCATAAACGAGCAGATGAGATATACGCAAAGCTGGATATAGTGGTTGATAAACTGAA
rJMSF011A18+ AAGTCATAAACGAGCAGATGAGATATACGCAAAGCTGGATATAGTGGTTGATAAACTGAA
                      ____________________________________________________________
consensus AAGTCATAAACGAGCAGATGAGATATACGCAAAGCTGGATATAGTGGTTGATAAACTGAA
 
. : . : . : . : . : . :
rJMSF017M20+ AGAGGCAGGATATGCCCCAGATACCAGTAGTGTTTTACTCGACTTAGACGAAGATGAGAA
rJMSF011A18+ AGAGGCAGGATATGCCCCAGATACCAGTAGTGTTTTACTCGACTTAGACGAAGATGAGAA
                      ____________________________________________________________
consensus AGAGGCAGGATATGCCCCAGATACCAGTAGTGTTTTACTCGACTTAGACGAAGATGAGAA
 
. : . : . : . : . : . :
rJMSF017M20+ GAAGGATGCAATTCTTTGGCACAGCGAGAAACTAGCGTTTTGTTATGGACTAATGAACAG
rJMSF011A18+ GAAGGATGCAATTCTTTGGCACAGCGAGAAACTAGCGTTTTGTTATGGACTAATGAACAG
                      ____________________________________________________________
consensus GAAGGATGCAATTCTTTGGCACAGCGAGAAACTAGCGTTTTGTTATGGACTAATGAACAG
 
. : . : . : . : . : . :
rJMSF017M20+ CGAAAGAGGCTCTAGCATACGCATCATCAAGAACCTAAGGGTCTGCGAGGACTGTCATAA
rJMSF011A18+ CGAAAGAGGCTCTAGCATACGCATCATCAAGAACCTAAGGGTCTGCGAGGACTGTCATAA
                      ____________________________________________________________
consensus CGAAAGAGGCTCTAGCATACGCATCATCAAGAACCTAAGGGTCTGCGAGGACTGTCATAA
 
. : . : . : . : . : . :
rJMSF017M20+ CTTTATGAAGTTGGCATCGAGGGTGTTTGATAGGAAAATTGTTATGAGAGATAGGACTAG
rJMSF011A18+ CTTTATGAAGTTGGCATCGAGGGTGTTTGATAGGAAAATTGTTATGAGAGATAGGACTAG
                      ____________________________________________________________
consensus CTTTATGAAGTTGGCATCGAGGGTGTTTGATAGGAAAATTGTTATGAGAGATAGGACTAG
 
. : . : . : . : . : . :
rJMSF017M20+ ATTTCATCAATATGCAGATGGCCTCTGCTCATGTAAAGACTTCTGGTAAGTCTCGAGATT
rJMSF011A18+ ATTTCATCAATATGCAGATGGCCTCTGCTCATGTAAAGACTTCTGGTAAGTCTCGAGATT
                      ____________________________________________________________
consensus ATTTCATCAATATGCAGATGGCCTCTGCTCATGTAAAGACTTCTGGTAAGTCTCGAGATT