Previous Contig 011609:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011A14Sequence287005201 (2)775011609 (3)gb:AP003513_18301761e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P069
JMSF017C02Sequence390005201 (2)673011609 (3)gb:AP003513_18301765e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P069
JMSF036M10Sequence671019913762011609 (3)gb:AP005545_18538656e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P063

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036M10+ TAAAGAGATCTGGTCGTTTGCTTTCCTACAGTAGTTGCAAAACTATGGA
                      ____________________________________________________________
consensus TAAAGAGATCTGGTCGTTTGCTTTCCTACAGTAGTTGCAAAACTATGGA
 
. : . : . : . : . : . :
rJMSF036M10+ AGCTAATATACTGTTGCTGCAAGAAGCTGGTTTTTCAGATGATAAAATCCAACAGTTTGT
                      ____________________________________________________________
consensus AGCTAATATACTGTTGCTGCAAGAAGCTGGTTTTTCAGATGATAAAATCCAACAGTTTGT
 
. : . : . : . : . : . :
rJMSF036M10+ CATGGCAAGGCCACGTTATATAACAAATAAGCCTACTTGGATTGGCAATATTTTGAAAAG
rJMSF011A14+ TTGGATTGACAAGATTCTGAATAG
                      ____________________________________________________________
consensus CATGGCAAGGCCACGTTATATAACAAATAAGCCTACTTGGATTGGCAATATTTTGAATAG
 
. : . : . : . : . : . :
rJMSF036M10+ AGTGGAAATGGAGTTTGGGATTTCTCGAAACTCCCCAATGTTTTACTGCGGATTACTTGT
rJMSF011A14+ AGTGGAAAAGGAGTTTGGGATTCCTCGAGGCTCCCCAATGTTTTACAGTGGAGTGTTTGT
                      ____________________________________________________________
consensus AGTGGAAATGGAGTTTGGGATTTCTCGAGGCTCCCCAATGTTTTACTGTGGATTGTTTGT
 
. : . : . : . : . : . :
rJMSF036M10+ TGCAACTGCACTGAATAAGTCAACAGTGGACAAGAAACTTGAAATTTTCAGGAGCTATGG
rJMSF017C02+ CAACTGTGGACAGGAAACTTGAAATCTTGAGGAGCTTTGG
rJMSF011A14+ CGCGACTGCGCTGAGTACAGCAACTGTGGACAGGAAACTTGAAATCTTGAGGAGCTTTGG
                      ____________________________________________________________
consensus TGCGACTGCGCTGAGTACGTCAACTGTGGACAGGAAACTTGAAATCTTGAGGAGCTTTGG
 
. : . : . : . : . : . :
rJMSF036M10+ GTGGTCTAATTCAGAAATTTCTACCATGGTGC--AAACTACCCCATTCTTTAACTCTATC
rJMSF017C02+ GTGGTCGAATTCAGAAATTTCTACCATGGTGCAAAAACAACCTCATTCTTTAACTGTATC
rJMSF011A14+ GTGGTCGAATTCAGAAATTTCTACCATGGTGCAAAAACAACCTCATTCTTTAACTGTATC
                      ____________________________________________________________
consensus GTGGTCGAATTCAGAAATTTCTACCATGGTGCAAAAACAACCTCATTCTTTAACTGTATC
 
. : . : . : . : . : . :
rJMSF036M10+ AGAGGCTAGGTTGAAAAAGGTACTGAATTTTTTTATGAAGGAACTTGGGTATGAATCCTA
rJMSF017C02+ AGAGGATAGGTTGAAAAGGGTACTGAATTTTTTAATGAAGGAACTCGGCTATAGCTCCCA
rJMSF011A14+ AGAGGATAAGTTGAAAAGGGTACTGAATTTTTTAATGAAGGAACTCGGCTATAGCTCCCA
                      ____________________________________________________________
consensus AGAGGATAGGTTGAAAAGGGTACTGAATTTTTTAATGAAGGAACTCGGCTATAGCTCCCA
 
. : . : . : . : . : . :
rJMSF036M10+ TTACCTGGCTTTTCGGCCTATCATTCTAACATATAGTTTGGAGAAGAAGAGCATCCCTAG
rJMSF017C02+ TTACTTGGCTTTTCGCCCCATGTTTCTAATGTCTAGTTTGGAGAAGAAGACCATCCCTAG
rJMSF011A14+ TTACTTGGCTTTTCGCCCCATGTTTCTAATGTCTAGTTTGGAGAAGAAGACCATCCCTAG
                      ____________________________________________________________
consensus TTACTTGGCTTTTCGCCCCATGTTTCTAATGTCTAGTTTGGAGAAGAAGACCATCCCTAG
 
. : . : . : . : . : . :
rJMSF036M10+ GAGTCAAGTGTTGAAAACTCTTGAAGAAAATAAGCTGAGAGCGTGCTCTCTCTTTAC
rJMSF017C02+ GAGTCAAGTGTTGAAGATTCTTAAAGACAATCACCTGAGAGCATGCTCACTCTTTACCGC
rJMSF011A14+ GAGTCAAGTGTTGAAGATTCTTAAAGACAATCACCTGAGAGCATGCTCACTCTTTACCGC
                      ____________________________________________________________
consensus GAGTCAAGTGTTGAAGATTCTTAAAGACAATCACCTGAGAGCATGCTCACTCTTTACCGC
 
. : . : . : . : . : . :
rJMSF017C02+ AATATCATTGACTGAATCAAAGTTTTCTAAAGATTATCTGCTACCCTACAAGGATAAGCT
rJMSF011A14+ AATATCATTGACTGAATCAAAGTTTTCTAAAGATTATCTGCTACCCTACAAGGATAAGCT
                      ____________________________________________________________
consensus AATATCATTGACTGAATCAAAGTTTTCTAAAGATTATCTGCTACCCTACAAGGATAAGCT
 
. : . : . : . : . : . :
rJMSF017C02+ GCCTGAAATGTATCAAAGATACATAACAATTATGGAGATGTAGAACATGCAGTCATTTGT
rJMSF011A14+ GCCTGAAATGTATCAAAGATACATAACAAGTATGGAGATGTAGAACATGCAGTCATTTGT
                      ____________________________________________________________
consensus GCCTGAAATGTATCAAAGATACATAACAATTATGGAGATGTAGAACATGCAGTCATTTGT
 
. : . : . : . : . : . :
rJMSF017C02+ TCATCAATGCTATCCTCTTCTTTCCATATTAATACTGTAGTTGTTCTAAGTTTTGTGGGG
rJMSF011A14+ TCATCAATGCTATCCTCTTCTTTCCATATTAATACTGTAGTTGTTCTAAGTTTTGTGGGG
                      ____________________________________________________________
consensus TCATCAATGCTATCCTCTTCTTTCCATATTAATACTGTAGTTGTTCTAAGTTTTGTGGGG
 
. : . : . : . : . : . :
rJMSF017C02+ ATTGATTGGATTTGCTGAAATGCTCTTCATAATTGATGAATCATGAAAGATGTGCAGAGA
rJMSF011A14+ ATTGATTGGATTTGCTGAAATGCTCTTCATAATTGATGAATCATGAAAGATGTGCAGAGA
                      ____________________________________________________________
consensus ATTGATTGGATTTGCTGAAATGCTCTTCATAATTGATGAATCATGAAAGATGTGCAGAGA
 
. : . : . : . : . : . :
rJMSF017C02+ TTCCGTTCTTTCTTTAATTCAAGGCATAAAGCAGGGACAGTGTTGATACAATCTGATCAT
rJMSF011A14+ TTCCGTTCTTTCTTTAATTCAAGGCATAAAGCAGGGACAGTGTTGATACAATCTGATCAT
                      ____________________________________________________________
consensus TTCCGTTCTTTCTTTAATTCAAGGCATAAAGCAGGGACAGTGTTGATACAATCTGATCAT
 
. : . : . : . : . : . :
rJMSF017C02+ TAGTTGGACTTGGCCTGCAGTATGGTCATTATATATTGTACTTTAAGTTCAT
rJMSF011A14+ TAGTTGGACTTGGCCTGCAGTATGGTCATTATATATTGTACTTTAAGTTCATTGTTGATT
                      ____________________________________________________________
consensus TAGTTGGACTTGGCCTGCAGTATGGTCATTATATATTGTACTTTAAGTTCATTGTTGATT