Previous Contig 011604:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046J15Sequence521003045 (4)gb:BT002375_16359786e-21Arabidopsis thaliana expressed protein (At3g03770) mRNA, complete cds.421011604 (3)gb:AY084741_15698262e-23Arabidopsis thaliana clone 116488 mRNA, complete sequence.
JMSF011A01Sequence652011604 (3)gb:AY084741_15698265e-28Arabidopsis thaliana clone 116488 mRNA, complete sequence.
JMSF036D04Sequence687003045 (4)gb:BT002375_16359783e-38Arabidopsis thaliana expressed protein (At3g03770) mRNA, complete cds.661011604 (3)gb:AY084741_15698262e-44Arabidopsis thaliana clone 116488 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036D04+ TTTCAAACGATTTGAA
                      ____________________________________________________________
consensus TTTCAAACGATTTGAA
 
. : . : . : . : . : . :
rJMSF036D04+ GATAACCGATATTCTGTTGGACCAGAACCTCGTTGCCAAAATTAGCAGCTTTAACCTACC
                      ____________________________________________________________
consensus GATAACCGATATTCTGTTGGACCAGAACCTCGTTGCCAAAATTAGCAGCTTTAACCTACC
 
. : . : . : . : . : . :
rJMSF036D04+ CATTCTGGATGAGAGCACAGGAAAGGCCGGCCTTCATGATATTCCCAGTGGTTCCAAGGA
rJMSF011A01+ TGGATGAGAGCACAGGAAAGGCCGGCCTTCATGATATTCCCANTGGTTCCAAGGA
                      ____________________________________________________________
consensus CATTCTGGATGAGAGCACAGGAAAGGCCGGCCTTCATGATATTCCCAGTGGTTCCAAGGA
 
. : . : . : . : . : . :
rJMSF036D04+ GGTTAATGGTGCAAGGGAAAGATACAATGAAAAGCTGGATGTGTATGACTTTGGTACAAT
rJMSF011A01+ GGTTAATGGTGCAAGGGAAAGATACAATGAAAAGCTGGATGTGTATGACTTTGGTACAAT
                      ____________________________________________________________
consensus GGTTAATGGTGCAAGGGAAAGATACAATGAAAAGCTGGATGTGTATGACTTTGGTACAAT
 
. : . : . : . : . : . :
rJMFF046J15+ CAAGAAGGATGTGAAGATCCTTAA
rJMSF036D04+ ATTACTAGAAATCATTACAGGAAGGAGGATAAATACCAAGAAGGATGTGAAGATCCTTAA
rJMSF011A01+ ATTACTAGAAATCATTACAGGAAGGAGGATAAATACCAAGAAGGATGTGAAGATCCTTAA
                      ____________________________________________________________
consensus ATTACTAGAAATCATTACAGGAAGGAGGATAAATACCAAGAAGGATGTGAAGATCCTTAA
 
. : . : . : . : . : . :
rJMFF046J15+ AGAACAGTTGCAAGCAAGCCTCACAGGCGATGATGCATGGAGAAGGAGTGTGGTTGATCC
rJMSF036D04+ AGAACAGTTGCAAGCAAGCCTCACAGGCGATGATGCATGGAGAAGGAGTGTGGTTGATCC
rJMSF011A01+ AGAACAGTTGCAAGTAAGCCTCNCAGGCGATGATGCATGG---AGGAGTGTGGTTGATCC
                      ____________________________________________________________
consensus AGAACAGTTGCAAGCAAGCCTCACAGGCGATGATGCATGGAGAAGGAGTGTGGTTGATCC
 
. : . : . : . : . : . :
rJMFF046J15+ GAGGGTCAAGAATTCGAGTTCAGATGAATCGGTGAAGACGATGGTGGAGATTTGCTACAG
rJMSF036D04+ GAGGGTCAAGAATTCGAGTTCAGATGAATCGGTGAAGACGATGGTGGAGATTTGCTACAG
rJMSF011A01+ GAGGGTCAAGAATTCGAGTTCAGATGAATCGGTGAAGNCGATGGTGGAGATTTGCTACAG
                      ____________________________________________________________
consensus GAGGGTCAAGAATTCGAGTTCAGATGAATCGGTGAAGACGATGGTGGAGATTTGCTACAG
 
. : . : . : . : . : . :
rJMFF046J15+ ATGTTTGCTCGAGGATCCTGCAGATAGGCCGTCGGTTGAGGATGTGTTGTGGAATTTGCA
rJMSF036D04+ ATGTTTGCTCGAGGATCCTGCAGATAGGCCGTCGGTTGAGGATGTGTTGTGGAATTTGCA
rJMSF011A01+ ATGTTTGCTCGAGGATCCTGCAGATAGNCCGTCGGTTGNGGATNTGTTGTGGAATTTGCA
                      ____________________________________________________________
consensus ATGTTTGCTCGAGGATCCTGCAGATAGGCCGTCGGTTGAGGATGTGTTGTGGAATTTGCA
 
. : . : . : . : . : . :
rJMFF046J15+ GTTTGCGGCTCAGGTCCAAGACGCGTGTAGAGGAGATTCTCAGAGCAGCGATAGCTCTCC
rJMSF036D04+ GTTTGCGGCTCAGGTCCAAGACGCGTGTAGAGGAGATTCTCAGAGCAGCGATAGCTCTCC
rJMSF011A01+ GTTTGCGGCTCAGGTCCAAGACGCGTGTAGAGGAGATTCTCAGAGCAGCGATAGCTCTCC
                      ____________________________________________________________
consensus GTTTGCGGCTCAGGTCCAAGACGCGTGTAGAGGAGATTCTCAGAGCAGCGATAGCTCTCC
 
. : . : . : . : . : . :
rJMFF046J15+ CATTTCGCCTTTTCAGCCTTCACGCCAGATAGCCATTCGATAGCATGAGTGCATGAGAGG
rJMSF036D04+ CATTTCGCCTTTTCAGCCTTCACGCCAGATAGCCATTCGATAGCATGAGTGCATGAGAGG
rJMSF011A01+ CATTTCGCCTTTTCANCCTTCACNCCAGATAGCCATTCGATAGCATGAGTGCATGAGAGG
                      ____________________________________________________________
consensus CATTTCGCCTTTTCAGCCTTCACGCCAGATAGCCATTCGATAGCATGAGTGCATGAGAGG
 
. : . : . : . : . : . :
rJMFF046J15+ TGTTTTTGAGGAAGCAATGGCTATGGCTTTGCTTCAGAAGATTGAAGAGCTTTGTACTAA
rJMSF036D04+ TGTTTTTGAGGAAGCAATGGCTATGGCTTTGCTTCAGAAGATTGAAGAGCTTTGTACTAA
rJMSF011A01+ TGTTTTTGANGAAGCAATGNCTATGGCTNTGCTTCAGAAGANTGCAGAGCTTTGTACTAA
                      ____________________________________________________________
consensus TGTTTTTGAGGAAGCAATGGCTATGGCTTTGCTTCAGAAGATTGAAGAGCTTTGTACTAA
 
. : . : . : . : . : . :
rJMFF046J15+ TGAAAATGGTGAATGCAAATAGTTATCAGTTTTGT
rJMSF036D04+ TGAAAATGGTGAATGCAAATAGTTATCAGTTTTGTACAAAAAACC
rJMSF011A01+ TGAAAATNGTGAATGCAAATAGTTATCAGTTTTGTNCAAAAAACCATTTGATCTGCAGAA
                      ____________________________________________________________
consensus TGAAAATGGTGAATGCAAATAGTTATCAGTTTTGTACAAAAAACCATTTGATCTGCAGAA
 
. : . : . : . : . : . :
rJMSF011A01+ TATATAGAACAGTATCTTCTCCTTATATGTCACCAAAATGTCTACATGAGAGGNTCAAAA
                      ____________________________________________________________
consensus TATATAGAACAGTATCTTCTCCTTATATGTCACCAAAATGTCTACATGAGAGGNTCAAAA