Previous Contig 011603:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010P17Sequence245018695762011603 (2)gb:AP002524_18223926e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF011H19Sequence421011603 (2)gb:AP002524_18223923e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040747022428

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011H19- GGGATTGAAACTTTTCTGAGGTG
                      ____________________________________________________________
consensus GGGATTGAAACTTTTCTGAGGTG
 
. : . : . : . : . : . :
JMSF011H19- ACTCATCAATTAAAGGTCAACATGTAGCGTTGATGGCCGCTGTTGCGGAATGGATTCCAG
                      ____________________________________________________________
consensus ACTCATCAATTAAAGGTCAACATGTAGCGTTGATGGCCGCTGTTGCGGAATGGATTCCAG
 
. : . : . : . : . : . :
JMSF011H19- CGCTGATTTCAAATATATCCTCCAATGTTCCCTCGGCTCCAACCATCATTCCTGTGGCAA
                      ____________________________________________________________
consensus CGCTGATTTCAAATATATCCTCCAATGTTCCCTCGGCTCCAACCATCATTCCTGTGGCAA
 
. : . : . : . : . : . :
JMSF011H19- AAAGAACATCAGTTTTTTATGATCCAACGATAGAGATTCAAGAGTTGACAGCTGTGATCA
                      ____________________________________________________________
consensus AAAGAACATCAGTTTTTTATGATCCAACGATAGAGATTCAAGAGTTGACAGCTGTGATCA
 
. : . : . : . : . : . :
JMSF011H19- AGCAGGACATCTCTGCACTTAATGCCGCTGTAGTAGATCTGCAACTCCTTAGCAACTCCC
rJMSF010P17+ TTAATGCCGCTGTAGTAGATNTGCAGCTCCTTAGCAACTCGC
                      ____________________________________________________________
consensus AGCAGGACATCTCTGCACTTAATGCCGCTGTAGTAGATCTGCAGCTCCTTAGCAACTCGC
 
. : . : . : . : . : . :
JMSF011H19- AAAATGAAAGTGGAAGTATGTCTACAGACACAATGACCCATACAACCACTG----TGACA
rJMSF010P17+ AAAATGAAAGTGGAAGCATGTCTACAGACACGACCACCCATACAACCACTGTTGTTGACA
                      ____________________________________________________________
consensus AAAATGAAAGTGGAAGTATGTCTACAGACACGATGACCCATACAACCACTGTTGTTGACA
 
. : . : . : . : . : . :
JMSF011H19- ACCTTAAAAATCGCTTAATGAGCACCACAAAGGAGTTCAAAGAGGTCCTCACCATTCGGA
rJMSF010P17+ ACCTTAAAAATCGCTTAATGAGCACCACAAAGGAGTTCAAAGAGGTCCTCACCATTCGGA
                      ____________________________________________________________
consensus ACCTTAAAAATCGCTTAATGAGCACCACAAAGGAGTTCAAAGAGGTCCTCACCATTCGGA
 
. : . : . : . : . : . :
JMSF011H19- CCGAG
rJMSF010P17+ CCGAGAACTTGAAGGTTCATGAGAACAGAAGGCAGCTATTTTCTTCAAATGCATCAAAAG
                      ____________________________________________________________
consensus CCGAGAACTTGAAGGTTCATGAGAACAGAAGGCAGCTATTTTCTTCAAATGCATCAAAAG
 
. : . : . : . : . : . :
rJMSF010P17+ AGTCCACTAATCCTTTCATTCGCCAGCGTCCCTTAGCTACCAGAGCAGCTGCTAGTAGCT
                      ____________________________________________________________
consensus AGTCCACTAATCCTTTCATTCGCCAGCGTCCCTTAGCTACCAGAGCAGCTGCTAGTAGCT
 
. : . : . : . : . : . :
rJMSF010P17+ CTGCATCAGTATCTCCCCCTCCATGGGTTAATAAGTCTGCATCCTCATCTCAGTTACCTC
                      ____________________________________________________________
consensus CTGCATCAGTATCTCCCCCTCCATGGGTTAATAAGTCTGCATCCTCATCTCAGTTACCTC
 
. : . : . : . : . : . :
rJMSF010P17+ TTAGAAACAAGGCAGATGGAGAATCCCAGCCATTGCTACAACAGCAGCAAGGTCAACAGC
                      ____________________________________________________________
consensus TTAGAAACAAGGCAGATGGAGAATCCCAGCCATTGCTACAACAGCAGCAAGGTCAACAGC
 
. : . : . : . : . : . :
rJMSF010P17+ AGCAACAGTTGGCTCCTTTACAAGACAGTTACACGCAAAGCAGGAATCAGGCCCTTCATA
                      ____________________________________________________________
consensus AGCAACAGTTGGCTCCTTTACAAGACAGTTACACGCAAAGCAGGAATCAGGCCCTTCATA
 
. : . : . : . : . : . :
rJMSF010P17+ GTGTTGAATCAACTATTCATGAGTTGAGTAGCATTTTCACACAATTGGCAACCATGGTTT
                      ____________________________________________________________
consensus GTGTTGAATCAACTATTCATGAGTTGAGTAGCATTTTCACACAATTGGCAACCATGGTTT
 
. : . : . : . : . : . :
rJMSF010P17+ CTCAGCAAGGGGAACTGGCAATCAGGATCGACGAAAACATGGAAGACACGCTGGCAAATG
                      ____________________________________________________________
consensus CTCAGCAAGGGGAACTGGCAATCAGGATCGACGAAAACATGGAAGACACGCTGGCAAATG
 
. : . : . : . : . : . :
rJMSF010P17+ TGGAAGGGGCACAAGGGCAACTGATGAGGTACTTCAACAGCATATCATCCAACAGGTGGC
                      ____________________________________________________________
consensus TGGAAGGGGCACAAGGGCAACTGATGAGGTACTTCAACAGCATATCATCCAACAGGTGGC
 
. : . : . : . : . : . :
rJMSF010P17+ TAATGATCAAGATATTCCTGGTATTGATTGTATTCCTCATGATCTTCCTATTCTTTGTAG
                      ____________________________________________________________
consensus TAATGATCAAGATATTCCTGGTATTGATTGTATTCCTCATGATCTTCCTATTCTTTGTAG
 
. : . : . : . : . : . :
rJMSF010P17+ CCTAAATCTTTCTGTAAATTGGGATGAAAAGAAATATTTTTCCCTTTTTTTCTTTATTAT
                      ____________________________________________________________
consensus CCTAAATCTTTCTGTAAATTGGGATGAAAAGAAATATTTTTCCCTTTTTTTCTTTATTAT