Previous Contig 011599:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007B20Sequence303018509gb:AK118042_18160422e-34Arabidopsis thaliana At5g59810 mRNA for putative subtilisin-like protease, compl817011599 (2)gb:AY277949_15945093e-79Glycine max subtilisin-like protease (SUB1) gene, complete cds.
JMSF010P02Sequence292007415 (2)gb:AY277949_15945093e-22Glycine max subtilisin-like protease (SUB1) gene, complete cds.628011599 (2)gb:AY277949_15945095e-46Glycine max subtilisin-like protease (SUB1) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007B20+ AGTGAATGTGATAGCTGCCTTCACAGAAGC
                      ____________________________________________________________
consensus AGTGAATGTGATAGCTGCCTTCACAGAAGC
 
. : . : . : . : . : . :
rJMSF007B20+ CACAGGGGCATCTGATAAAGATTATGATAAGAGGATTATTTCATTCAACTNGGAATCAGG
                      ____________________________________________________________
consensus CACAGGGGCATCTGATAAAGATTATGATAAGAGGATTATTTCATTCAACTNGGAATCAGG
 
. : . : . : . : . : . :
rJMSF007B20+ GACTTCAATGTCATGCCCTCATGTAGCTGGTGTTGTTGGCCTTCTCAAAACGCTGTATCC
                      ____________________________________________________________
consensus GACTTCAATGTCATGCCCTCATGTAGCTGGTGTTGTTGGCCTTCTCAAAACGCTGTATCC
 
. : . : . : . : . : . :
rJMSF007B20+ TTCATGGAGCCCTGCAGAAATCAGATCTGCTATTATGACCACTGCCACAGTAAGAGCCAA
                      ____________________________________________________________
consensus TTCATGGAGCCCTGCAGAAATCAGATCTGCTATTATGACCACTGCCACAGTAAGAGCCAA
 
. : . : . : . : . : . :
rJMSF007B20+ CTCGGGGAAGGCGATAACTGACGACAAAACTGGACTGAAAACAACCCCATTTGCATATGG
rJMSF010P02+ GACTGAAAGCAACCCCATTTGCATATGG
                      ____________________________________________________________
consensus CTCGGGGAAGGCGATAACTGACGACAAAACTGGACTGAAAGCAACCCCATTTGCATATGG
 
. : . : . : . : . : . :
rJMSF007B20+ AGCTGGACACGTAAACCCAAACGGCGCTGCAGATCCTGGCTTGGTCTACGACTTGAAACT
rJMSF010P02+ AGCTGGACACATAAACCCAAACCGCGCTGCAGATCCTGGCTTGGTNTACGACTTGAAACT
                      ____________________________________________________________
consensus AGCTGGACACGTAAACCCAAACGGCGCTGCAGATCCTGGCTTGGTCTACGACTTGAAACT
 
. : . : . : . : . : . :
rJMSF007B20+ CACGGATTATGTCAACTTCATCTGCGCACAAGGCTACAACAAAACTGAGATCACGGCAGT
rJMSF010P02+ CACGGATTATGTCAACTTCATTTGCTCACAAGGCTACAATCAAACTGAGATCATGGCCNT
                      ____________________________________________________________
consensus CACGGATTATGTCAACTTCATTTGCTCACAAGGCTACAATCAAACTGAGATCATGGCCGT
 
. : . : . : . : . : . :
rJMSF007B20+ TTTAGGGACACCATACAAGTGCCCAGACCACATTAGTCTCTCCACCTTCAACTATCCCTC
rJMSF010P02+ TTTAGGGNCNCCATACAAGTGCCCNGNCCNCNTTAGTCTNTCCNCCTTCAACTATCCCTC
                      ____________________________________________________________
consensus TTTAGGGACACCATACAAGTGCCCAGACCACATTAGTCTCTCCACCTTCAACTATCCCTC
 
. : . : . : . : . : . :
rJMSF007B20+ AATCACTGTCCCTCACCTCAAAGGCACAGCCACCGTAACAAGAACTCTGAAAAACGTCGG
rJMSF010P02+ AATTGCTGTCCCTCACCTCAAAGGCACAGCCNCCGTGACAAGAACTTTGAAGAACGTNGG
                      ____________________________________________________________
consensus AATTGCTGTCCCTCACCTCAAAGGCACAGCCACCGTGACAAGAACTTTGAAGAACGTCGG
 
. : . : . : . : . : . :
rJMSF007B20+ CTCTCCGGCTACCTACACAGCTTCTGTTCGTAGCCCGGTTGGATTCTCTGTCACTGTGAA
rJMSF010P02+ CTNTCCGGCTACCTACACAGNTTNTGTTTGTAGCCCGATTGGATTNTNTGTCNCTGTGAA
                      ____________________________________________________________
consensus CTCTCCGGCTACCTACACAGCTTCTGTTTGTAGCCCGGTTGGATTCTCTGTCACTGTGAA
 
. : . : . : . : . : . :
rJMSF007B20+ TCCCAAGATTCTCAAGTTCGAAAAGGTTGGCGAGGAGCAAAGTTTCAAAGTTACTCTCAA
rJMSF010P02+ CCCCNAGATTNTCAAGTTNGAAAAGGTTGGTGAGGAGCAAAGTTTCAAGGTTAGTNTCAA
                      ____________________________________________________________
consensus TCCCAAGATTCTCAAGTTCGAAAAGGTTGGTGAGGAGCAAAGTTTCAAGGTTAGTCTCAA
 
. : . : . : . : . : . :
rJMSF007B20+ GGCAAAGGGGGAAAACGCTACGGCTGATTATGCATTTGGGGTGTTAACATGGTCTGATAA
rJMSF010P02+ TGCAAAGGGGGAAAACGNTACTGCTGATTATGCNTTTGGGGNGTTAACNTGGTTTGATAA
                      ____________________________________________________________
consensus TGCAAAGGGGGAAAACGCTACTGCTGATTATGCATTTGGGGTGTTAACATGGTTTGATAA
 
. : . : . : . : . : . :
rJMSF007B20+ AAAGCACCGTGTGAGAAGTCCCATTGTTGTGAAA
rJMSF010P02+ AAAGCCCCGTGTGAGAAGTCCCNTTGTTGTGAAAGCNGCAGCGTAGATGACAATCNTTAT
                      ____________________________________________________________
consensus AAAGCCCCGTGTGAGAAGTCCCATTGTTGTGAAAGCNGCAGCGTAGATGACAATCNTTAT
 
. : . : . : . : . : . :
rJMSF010P02+ GGNCCNGGTCCNCNCTCCNCAATGCNTTGTAAATCCTGATTCTATATTCGTTNTGAATTC
                      ____________________________________________________________
consensus GGNCCNGGTCCNCNCTCCNCAATGCNTTGTAAATCCTGATTCTATATTCGTTNTGAATTC
 
. : . : . : . : . : . :
rJMSF010P02+ TAATTTTGATGGNGATTTTTTTTTTTGAATGCTACTGGCTCTATTACCAATGTAGTATAT
                      ____________________________________________________________
consensus TAATTTTGATGGNGATTTTTTTTTTTGAATGCTACTGGCTCTATTACCAATGTAGTATAT