Previous Contig 011596:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013B09Sequence459001236 (5)gb:AY093171_15751251e-16Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820362011596 (10)
JMFF019C09Sequence103011596 (10)
JMFF026D03Sequence532001236 (5)gb:AY093171_15751259e-15Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820588011596 (10)gb:AY730338_16254381e-24Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMFF035F17Sequence541001236 (5)gb:AY093171_15751251e-28Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820654011596 (10)gb:AY730338_16254381e-24Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMSF008G08Sequence424001236 (5)667011596 (10)gb:AY730338_16254382e-22Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMSF010O12Sequence229011596 (10)gb:AY093171_15751254e-12Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820701011596 (10)gb:AY730338_16254388e-14Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMSF011O12Sequence245011596 (10)gb:AY093171_15751254e-12Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820684011596 (10)gb:AY730338_16254382e-10Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.
JMSF043C07Sequence792001236 (5)gb:AY093171_15751251e-30Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820631011596 (10)gb:AY730338_16254382e-17Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026D03+ TCATCCATCCACCCATCACCACA
rJMFF035F17+ CCNTCATCCATCCACCCATCACCACA
rJMSF008G08+ CA
                      ____________________________________________________________
consensus CCNTCATCCATCCACCCATCACCACA
 
. : . : . : . : . : . :
rJMFF026D03+ CATGAAAGGGAGAAAGCGGTTCCGAACAAAATTCACCCAAGATCAGAAAGGTAAAATGCT
rJMFF035F17+ CATGAAAGGGAGAAAGCGGTTCCGAACAAAATTCACCCAAGATCAGAAAGGTAAAATGCT
rJMSF008G08+ CATGAAAGGGAGAAAGNGGTTCCGAACAAAATTCACCCAAGTTCAGAAAGGTAAAATGNT
rJMSF043C07+ AAAGGTAAAATGCT
                      ____________________________________________________________
consensus CATGAAAGGGAGAAAGCGGTTCCGAACAAAATTCACCCAAGATCAGAAAGGTAAAATGCT
 
. : . : . : . : . : . :
rJMFF026D03+ GGATTTCGCGGAGAGGATCGGGTGGAAGATTCAGAAGAGAGACGAAGAACTGATCAACGA
rJMFF035F17+ GGATTTCGCGGAGAGGATCGGGTGGAAGATTCAGAAGAGAGACGAAGAACTGATCAACGA
rJMSF008G08+ GGATTTCGCGGAGAGGATCGGGTGGAAGATTCAGAAGAGNGACGAAGAACTGATCAACGA
JMSF011O12- GGGTGGAAGATTCAGAAGAGAGACGAAGAACTGATCAACGA
JMSF010O12- GGGTGGAAGATTCAGAAGAGAGACGAAGAACTGATCAACGA
rJMSF043C07+ GGATTTCGCGGAGAGGATCGGGTGGAAGATTCAGAAGAGAGACGAAGAACTGATCAACGA
rJMSF011O12+ GATTCAGAAGAGAGACGAAGAACTGATCAACGA
rJMSF010O12+ GGGTGGAAGATTCAGAAGAGAGACGAAGAACTGATCAACGA
                      ____________________________________________________________
consensus GGATTTCGCGGAGAGGATCGGGTGGAAGATTCAGAAGAGAGACGAAGAACTGATCAACGA
 
. : . : . : . : . : . :
rJMFF026D03+ TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
rJMFF035F17+ TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
rJMSF008G08+ TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
JMSF011O12- TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
JMSF010O12- TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
rJMSF043C07+ TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
rJMSF011O12+ TTTNTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
rJMSF010O12+ TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
                      ____________________________________________________________
consensus TTTCTGCCGTGAAATTGGAGTCGAGAGAGGAGTTTTAAAGGTCTGGATGCATAACAACAA
 
. : . : . : . : . : . :
rJMFF013B09+ CAAGAGAGATAACATCANCACCACCCCCGCAGCCGCCGCCGCCGCCGA
rJMFF026D03+ GAACACTGTCGGCAAGAGAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
rJMFF035F17+ GAACACTGTCGGCAAGAGAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
rJMSF008G08+ GAACACNGTNGGCAAGAGAGATAACATCNCCACCACCCCCGCAGCCGCCGCCGCCGCCGA
JMSF011O12- GAACACTGTCGGCAAGATAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
JMSF010O12- GAACACTGTCGGCAAGATAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
rJMSF043C07+ GAACACTGTCGGCAAGAGAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
rJMSF011O12+ GAACACTGTCGGCAAGATAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
rJMSF010O12+ GAACACTGTCGGCAAGATAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
                      ____________________________________________________________
consensus GAACACTGTCGGCAAGATAGATAACATCACCACCACCCCCGCAGCCGCCGCCGCCGCCGA
 
. : . : . : . : . : . :
rJMFF013B09+ TAACGGAAATGCTCACAGTCTCGGTTTNGACATCGGCCGCGTAAACTCCGCCCCACTCAC
rJMFF026D03+ TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAACTCCGCCCCACTCAC
rJMFF035F17+ TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAACTCCGCCCCACTCAC
rJMSF008G08+ TAACGGAAATGCTCACAGTNTNGGTTTTGACATNGGCCGCGTAAACTCCGCCCCANTCAC
JMSF011O12- TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAACTCCGCCCCACTCAC
JMSF010O12- TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAACTCCGCCCCACTCAC
rJMSF043C07+ TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAACTCCGCCCCACTCAC
rJMSF011O12+ TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAANTCCGCCCCACTCAC
rJMSF010O12+ TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAACTCCGCCCCACTCAC
                      ____________________________________________________________
consensus TAACGGAAATGCTCACAGTCTCGGTTTCGACATCGGCCGCGTAAACTCCGCCCCACTCAC
 
. : . : . : . : . : . :
rJMFF013B09+ CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCAGTA
rJMFF026D03+ CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCACTA
rJMFF035F17+ CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCACTA
rJMSF008G08+ CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCACTA
JMSF011O12- CTCCGACTTCAACCTCCGTCCAGA
JMSF010O12- CTCCGACT
rJMSF043C07+ CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCACTA
rJMSF011O12+ CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCACTA
rJMSF010O12+ CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCACTA
                      ____________________________________________________________
consensus CTCCGACTTCAACCTCCGTCCAGAAAGCAACAACAACGGCAGCCATAGCCAAAACCACTA
 
. : . : . : . : . : . :
rJMFF013B09+ CGCCCTCCACAGCGGCGACGTTCTCGCCGCCAATGGGTNGTCGTCTTCTTCNTGATCCGG
rJMFF019C09+ ACGTTCTCGCCGCCAANGGGTCGTCGTCTTCTTCNNGATCCGG
rJMFF026D03+ CGCCCTCCACAGCGGCGACGTTCTCGCCGCCAATGGGTCGTCGTCTTCTTCCTGATCCGG
rJMFF035F17+ CGCCCTCCACAGCGGCGACGTTCTCGCCGCCAATGGGTCGTCGTCTTCTTCCTGATCCGG
rJMSF008G08+ CGCCCTCCACAGCGGNGACGTTNTCGCCGCCAATGGGTCGTCGTCTTNTTCCTGATCCGG
rJMSF043C07+ CGCCCTCCACAGCGGCGACGTTCTCGCCGCCAATGGGTCGTCGTCTTCTTCCTGATCCGG
rJMSF011O12+ CGCCCTCCACAGCGGCGACGTTCTCGCCGCCAANGGGTCGTCGTCTTNTTCCTGATCCGG
rJMSF010O12+ CGCCCTCCACAGCGGCGACGTTCTCGCCGCCAATGGGTCGTCGTCTTCTTCCTGATCCGG
                      ____________________________________________________________
consensus CGCCCTCCACAGCGGCGACGTTCTCGCCGCCAATGGGTCGTCGTCTTCTTCCTGATCCGG
 
. : . : . : . : . : . :
rJMFF013B09+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATCTGCGGCAAAATNTGCAGGAAACAC
rJMFF019C09+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATNTGCGGCAAAATNTGCAGGAAACAC
rJMFF026D03+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATCTGCGGCAAAATTTGCAGGAAACAC
rJMFF035F17+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATCTGCGGCAAAATTTGCAGGAAACAC
rJMSF008G08+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATTTGCGGCAAAATTTGCAGGAAACNC
rJMSF043C07+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATNTGCGGCAAAATTTGCAGGAAACAC
rJMSF011O12+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATCTGCGGCAAAATTTGCAGGAAACAC
rJMSF010O12+ CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATCTGCGGCAAAATTTGCAGGAAACAC
                      ____________________________________________________________
consensus CACGTGGAAGGGGAGAATAAAAAAGATTTTAGAATCTGCGGCAAAATTTGCAGGAAACAC
 
. : . : . : . : . : . :
rJMFF013B09+ AACCAACTATGGTGAGGCCAGTACTGTTCTATCNTAGCTACTGCTTATTCACAAAGAGCC
rJMFF026D03+ AACCAACTATGGTGAGGCCAGTACTGTTCTATCTTAGCTACTGCTTATTCACAAAGAGCC
rJMFF035F17+ AACCAACTATGGTGAGGCCAGTACTGTTCTATCTTAGCTACTGCTTATTCACAAAGAGCC
rJMSF008G08+ AACCAACTATGGNGAGGCCAGTACTGTTCTATCTTAGCTANTGCTTATTCNCAAAGAGCC
rJMSF043C07+ AACCAACTATGGTGAGGCCAGTACTGTTCTATCTTAGCTACTGCTTATTCACAAAGAGCC
rJMSF011O12+ AACCAACTATGGTGAGGCCAGTACTGTTCTATCTTAGCTACTGCTTATTCACAAAGAGCC
rJMSF010O12+ AACCAACTATGGTGAGGCCAGTACTGTTCTATCTTAGCTACTGCTTATTCACAAAGAGCC
                      ____________________________________________________________
consensus AACCAACTATGGTGAGGCCAGTACTGTTCTATCTTAGCTACTGCTTATTCACAAAGAGCC
 
. : . : . : . : . : . :
rJMFF013B09+ TATTTTAGATCT
rJMFF026D03+ TATTTTAGATCTTCTGTTTCGAC
rJMFF035F17+ TATTTTAGATCTTCTGTTTCGACTGTTCTTAATGATTAGTGCTCTGATCTGAGGAAAAAT
rJMSF008G08+ TATTTTAGATNTTNTGNTTCGACTGTTTTTAATGATTAGTGCTNTGATNNGAGGAAAAAT
rJMSF043C07+ TATTTTAGATCTTCTGTTTCGACTGTTCTTAATGATTAGTGCTCTGATCTGAGGAAAAAT
rJMSF011O12+ TATTTTAGATCTTCTGTTTCGACTGTTCTTAATGATTAGTGCTCTGATCTGAGGAAAAAT
rJMSF010O12+ TATTTTAGATCTTCTGTTTCGACTGTTCTTAATGATTAGTGCTCTGATCTGAGGAAAAAT
                      ____________________________________________________________
consensus TATTTTAGATCTTCTGTTTCGACTGTTCTTAATGATTAGTGCTCTGATCTGAGGAAAAAT
 
. : . : . : . : . : . :
rJMFF035F17+ CTGCAGAACATCGTTCTGATGAGCAATT
rJMSF008G08+ NTGCAGAACATCGTTNTGATGAGCAATTTAATNNGTTTATTTTTCATTCTCATCATCCTG
rJMSF043C07+ CTGCAGAACATCGTTCTGATGAGCAATTTAATTTGTTTATTTTTCATTCTCATCATCCTG
rJMSF011O12+ NTGCAGAACATCGTTNTGATGAGCAATTTAATTTGTTTATTTTTCATTCTCATCATCCTG
rJMSF010O12+ CTGCAGAACATCGTTCTGATGAGCAATTTAATTTGTTTATTTTTCATTCTCATCATCCTG
                      ____________________________________________________________
consensus CTGCAGAACATCGTTCTGATGAGCAATTTAATTTGTTTATTTTTCATTCTCATCATCCTG
 
. : . : . : . : . : . :
rJMSF008G08+ ACCTG
rJMSF043C07+ ACCTGTAAATTATAACC
rJMSF011O12+ ACCTGTAAATTATAACCTTAATTAGGATCTCCAAAAAAAAATTGAGTCTTTTCCCATTTT
rJMSF010O12+ ACCTGTAAATTATAACCTTAATTAGGATCTCCAAAAAAAAATTGAGTCTTTTCCCATTTT
                      ____________________________________________________________
consensus ACCTGTAAATTATAACCTTAATTAGGATCTCCAAAAAAAAATTGAGTCTTTTCCCATTTT
 
. : . : . : . : . : . :
rJMSF011O12+ CCTTTGTTTCTTGAATCTTGAATCCTCCCTCCCCTTCCACCATT
rJMSF010O12+ CCTTTGTTTCTTGAATCTTGAATCCTCCCTCCCCTTCCACCATTCTTTCTCCATTGATGG
                      ____________________________________________________________
consensus CCTTTGTTTCTTGAATCTTGAATCCTCCCTCCCCTTCCACCATTCTTTCTCCATTGATGG