Previous Contig 011594:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007H12Sequence607011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.577011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF011L13Sequence466011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.447011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF013D01Sequence532011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.573011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF013H21Sequence582011594 (48)gb:AF116845_17694294e-29Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF014C21Sequence393011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF016E13Sequence468011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.456011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF019P17Sequence630011594 (48)gb:AF116845_17694293e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.605011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF022K23Sequence522011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.596011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF023D19Sequence462011594 (48)gb:AF116845_17694293e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.430011594 (48)gb:AF116845_17694293e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF023H05Sequence512011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.654011594 (48)gb:AF116845_17694293e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF038D12Sequence570011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF038D20Sequence505011594 (48)gb:AF116845_17694299e-18Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.463011594 (48)gb:AF116845_17694297e-18Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF038F01Sequence447011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.430011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF048C23Sequence457011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.493011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFF051F01Sequence420011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.421011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFN011C15Sequence606011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFN011G17Sequence588011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFN043E09Sequence597011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFN046H12Sequence146011594 (48)
JMFS002B05Sequence408011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMFS037A08Sequence583011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF010M21Sequence271018683pir|A85060|A850603e-44probable ABC transporter [imported] - Arabidopsis thaliana>gb:ATCHRIV13_1544321 736011594 (48)gb:AF116845_17694294e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF012O07Sequence434011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.514011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF016C17Sequence432011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.378011594 (48)gb:AF116845_17694291e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF018J13Sequence591011594 (48)gb:AF116845_17694293e-19Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.543011594 (48)gb:AF116845_17694292e-19Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF021M01Sequence605011594 (48)gb:AF116845_17694293e-19Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.546011594 (48)gb:AF116845_17694292e-19Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF027K08Sequence637011594 (48)gb:AF116845_17694293e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.578011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF041H11Sequence603011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.540011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.
JMSF052O02Sequence590011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.542011594 (48)gb:AF116845_17694292e-20Ipomoea batatas metallothionein-like type 1 protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019P17+ TTACACAA
JMSF021M01+ TTACACAA
rJMFF023H05- TATTAAATGAATATACACAAAATGAGTTACACAA
JMFN043E09+ CAA
JMFN011G17+ AA
JMFS037A08+ AA
JMFN011C15+ ACACAA
rJMFF013D01- TTACACAA
JMSF027K08+ TTACACAA
                      ____________________________________________________________
consensus TATTAAATGAATATACACAAAATGAGTTACACAA
 
. : . : . : . : . : . :
JMFF019P17+ CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACNTCTTTCAATATACAT
JMSF021M01+ CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
rJMFF023H05- CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
JMFN043E09+ CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
JMFN011G17+ CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
JMFS037A08+ CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
JMFN011C15+ CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
JMFF007H12+ TTTTTGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
JMSF041H11+ TTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
rJMFF022K23- ATTTTAGTTC-ATACAGTACAGTCAACCTCTTTCAATATACAT
rJMFF019P17- CATTTTAGTTC-ATACAGTACAGTCAACCTCTTTCAATATACAT
JMSF018J13+ AATACAGTACAGTCAACCTCTTTCAATATACAT
JMSF052O02+ TACAGTCAACCTCTTTCAATATACAT
rJMSF021M01- ACCTCTTTC-ATATACAT
rJMFF007H12- ACCTCTTTC-ATATACAT
rJMSF027K08- ACCTCTTTC-ATATACAT
JMFF038D12+ TCAATATACAT
rJMFF013D01- CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
rJMFF013H21- CAGTCAACCTCTTTC-ATATACNT
JMSF027K08+ CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
rJMSF010M21- ACCTCTTTC-ATATACAT
                      ____________________________________________________________
consensus CATACATTATTGATACCATTTTAGTTCAATACAGTACAGTCAACCTCTTTCAATATACAT
 
. : . : . : . : . : . :
rJMSF052O02- CAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFF019P17+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMSF021M01+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMFF023H05- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFN043E09+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFN011G17+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFS037A08+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFN011C15+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFF007H12+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMSF041H11- AACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMSF041H11+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMFF022K23- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMFF019P17- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMSF018J13- AACACCCAAGCAACCACACATTCCAAACATAAACGAATCACACAA
JMSF018J13+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAACGAATCACACAA
JMSF052O02+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMSF021M01- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFF013D01+ AACCACACATTCCAAACATAAATGAATCACACAA
rJMFF007H12- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMSF027K08- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFF038D12+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMFF013D01- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
JMFF022K23+ ACATTCCAAACATAAATGAATCACACAA
JMFF023H05+ TGAATCACACAA
rJMFF013H21- NAAGGATAAAGTCCAAACACCCNAGCNACCACACATTCCAAACATAAATGAATCACACAA
JMSF027K08+ TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
rJMSF010M21- TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
                      ____________________________________________________________
consensus TAAGGATAAAGTCCAAACACCCAAGCAACCACACATTCCAAACATAAATGAATCACACAA
 
. : . : . : . : . : . :
rJMSF052O02- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF019P17+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMSF021M01+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMFF023H05- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFN043E09+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFN011G17+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFS037A08+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFN011C15+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF048C23+ ATCTGCAATCTGCTTATTATT
rJMFF048C23- ATCTGCAATCTGCTTATTATT
JMFF007H12+ ATNTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMSF041H11- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMSF041H11+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMFF022K23- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMFF019P17- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMSF018J13- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMSF018J13+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMSF052O02+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMSF021M01- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF013D01+ ATNTAAGTGACACTTCAACAAAGATGTGCACAACTCATCATNTGCAATCTGCTTATTATT
rJMFF038D20- TCATCTGCAATCTGCTTATTATT
JMFF038D20+ TGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF023D19+ TCATCTGCAATCTGCTTATTATT
JMFF038F01+ TTATTATT
rJMFF007H12- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMSF027K08- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF038D12+ ATNTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMFF013D01- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF022K23+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF023H05+ ATNTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMFF013H21- ATCTAAGTGACACTTCAACNAAGATCTGCACAANTCATCATCTGCAATCTGCTTATTATT
JMFF016E13+ TGCACAACTCATCATCTGCAATCTGCTTATTATT
JMFF011L13+ TCATCTGCAATCTGCTTATTATT
rJMFF016E13- ATCTGCTTATTATT
rJMFF011L13- TCTGCTTATTATT
JMSF027K08+ ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
rJMSF010M21- ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
                      ____________________________________________________________
consensus ATCTAAGTGACACTTCAACAAAGATCTGCACAACTCATCATCTGCAATCTGCTTATTATT
 
. : . : . : . : . : . :
rJMSF052O02- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF019P17+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMSF021M01+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF023H05- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFN043E09+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFN011G17+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFS037A08+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFN011C15+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF048C23+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF048C23- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF038F01- ATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF051F01- ATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGACCATACA
JMFF051F01+ ATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFS002B05+ ATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF007H12+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMSF041H11- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMSF041H11+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF022K23- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF019P17- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMSF018J13- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMSF018J13+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMSF052O02+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMSF021M01- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF013D01+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF038D20- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF038D20+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF023D19- TCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF023D19+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF038F01+ ACANTNATCATATATCATCANNGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF007H12- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMSF027K08- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF038D12+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF013D01- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF022K23+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF023H05+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF013H21- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTANTTATCATCAGTACATACA
JMFF016E13+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMFF011L13+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF016E13- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF011L13- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
JMSF016C17+ TCATCACTGCAAAGGCCCCATCCATTAATTATCATCAGTACATACA
rJMFF014C21- TATCATCAGTACATACA
JMSF027K08+ ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
rJMSF010M21- ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
                      ____________________________________________________________
consensus ACACTCATCATATATCATCACTGCAAAAGCCCCATCCATTAATTATCATCAGTACATACA
 
. : . : . : . : . : . :
rJMSF052O02- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF019P17+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMSF021M01+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF023H05- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFN043E09+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFN011G17+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFS037A08+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFN011C15+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF048C23+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF048C23- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF038F01- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF051F01- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF051F01+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFS002B05+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF007H12+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMSF041H11- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMSF041H11+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF022K23- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF019P17- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMSF018J13- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMSF018J13+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMSF052O02+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMSF021M01- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF013D01+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF038D20- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF038D20+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF023D19- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF023D19+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF038F01+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATNTATCC
rJMFF007H12- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMSF027K08- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF038D12+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF013D01- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF022K23+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF023H05+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF013H21- NAGATATGNATATATATATATATTTANACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF016E13+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMFF011L13+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF016E13- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF011L13- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMSF016C17- GTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMSF016C17+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMFF014C21- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
JMSF027K08+ CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
rJMSF010M21- CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
                      ____________________________________________________________
consensus CAGATATGTATATATATATATATTTAGACAAACCCTAATAAGACATGCTCCGATCTATCC
 
. : . : . : . : . : . :
rJMSF052O02- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF019P17+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMSF021M01+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAAAAGTTGC-AA
rJMFF023H05- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AG
JMFN043E09+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFN011G17+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFS037A08+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFN011C15+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF048C23+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF048C23- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF038F01- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF051F01- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF051F01+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCCTACAGTTGC-AA
JMFS002B05+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF007H12+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMSF041H11- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMSF041H11+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF022K23- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF019P17- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMSF018J13- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMSF018J13+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMSF052O02+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMSF021M01- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAAAAGTTGC-AA
JMFF013D01+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF038D20- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGNTGCAAA
JMFF038D20+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGCAAA
rJMFF023D19- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF023D19+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF038F01+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF007H12- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMSF027K08- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF038D12+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF013D01- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF022K23+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF023H05+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AG
rJMFF013H21- ATACATAGCTTGAAGGGGTGATTATTATATTTGCNCTATTTTACCCCTAACAGTTGC-AA
JMFF016E13+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMFF011L13+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF016E13- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF011L13- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMSF016C17- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMSF016C17+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMFF014C21- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMSF012O07+ ATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMSF012O07- ATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
JMSF027K08+ ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
rJMSF010M21- ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
                      ____________________________________________________________
consensus ATACATAGCTTGAAGGGGTGATTATTATATTTGCACTATTTTAGCCCTAACAGTTGC-AA
 
. : . : . : . : . : . :
rJMSF052O02- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF019P17+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMSF021M01+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF023H05- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFN043E09+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFN011G17+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFS037A08+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFN011C15+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF048C23+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF048C23- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF038F01- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF051F01- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF051F01+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFS002B05+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF007H12+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMSF041H11- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMSF041H11+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF022K23- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF019P17- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMSF018J13- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMSF018J13+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMSF052O02+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMSF021M01- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF013D01+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF038D20- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF038D20+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF023D19- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF023D19+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF038F01+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF007H12- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMSF027K08- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF038D12+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF013D01- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF022K23+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF023H05+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF013H21- GGGTCACAGGTGCAGNTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF016E13+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMFF011L13+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF016E13- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF011L13- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMSF016C17- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMSF016C17+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMFF014C21- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMSF012O07+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMSF012O07- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
JMSF027K08+ GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
rJMSF010M21- GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
                      ____________________________________________________________
consensus GGGTCACAGGTGCAGTTTGATCCACATTTGCAGCCATGTCCCCCCTCTGTAGCCTTCTCA
 
. : . : . : . : . : . :
rJMSF052O02- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF019P17+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMSF021M01+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF023H05- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFN043E09+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFN011G17+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFS037A08+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFN011C15+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF048C23+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF048C23- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF038F01- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF051F01- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF051F01+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFS002B05+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFN046H12- CCCCCTTGATGATGGTAACGGTGGTG
JMFF007H12+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMSF041H11- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMSF041H11+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF022K23- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF019P17- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMSF018J13- GAAGATCCCTATAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMSF018J13+ GAAGATCCCTATAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMSF052O02+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMSF021M01- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF013D01+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF038D20- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF038D20+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF023D19- GCAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF023D19+ GCAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF038F01+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF007H12- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMSF027K08- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF038D12+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF013D01- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF022K23+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF023H05+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF013H21- GAAGATCCCTCTAAGCTCNACTTCANCGGNGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF016E13+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMFF011L13+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF016E13- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF011L13- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMSF016C17- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMSF016C17+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMFF014C21- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMSF012O07+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMSF012O07- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
JMSF027K08+ GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
rJMSF010M21- GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
                      ____________________________________________________________
consensus GAAGATCCCTCTAAGCTCAACTTCACCGGTGCAACCCCCTTGATGATGGTAACGGTGGTG
 
. : . : . : . : . : . :
rJMSF052O02- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF019P17+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMSF021M01+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF023H05- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFN043E09+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFN011G17+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFS037A08+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFN011C15+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF048C23+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF048C23- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF038F01- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF051F01- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF051F01+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFS002B05+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFN046H12- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF007H12+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMSF041H11- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMSF041H11+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF022K23- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF019P17- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMSF018J13- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMSF018J13+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMSF052O02+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMSF021M01- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF013D01+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF038D20- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF038D20+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF023D19- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF023D19+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF038F01+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF007H12- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMSF027K08- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF038D12+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF013D01- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF022K23+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF023H05+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF013H21- GTCACCTCTTCACATCCACAGTTACTGNCGCACTTGCAGTCGGAGCCNCACTTGCANCCG
JMFF016E13+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMFF011L13+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF016E13- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF011L13- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMSF016C17- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMSF016C17+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMFF014C21- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMSF012O07+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMSF012O07- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
JMSF027K08+ GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
rJMSF010M21- GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
                      ____________________________________________________________
consensus GTCACCTCTTCACATCCACAGTTACTGCCGCACTTGCAGTCGGAGCCACACTTGCAACCG
 
. : . : . : . : . : . :
rJMSF052O02- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF019P17+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMSF021M01+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTAT
rJMFF023H05- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFN043E09+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCT
JMFN011G17+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATT
JMFS037A08+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACT
JMFN011C15+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCA
JMFF048C23+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF048C23- GAAGACATCTCTTACCCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF038F01- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF051F01- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCCA
JMFF051F01+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFS002B05+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFN046H12- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF007H12+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMSF041H11- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMSF041H11+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF022K23- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF019P17- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMSF018J13- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMSF018J13+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMSF052O02+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMSF021M01- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTAT
JMFF013D01+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF038D20- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF038D20+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF023D19- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF023D19+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF038F01+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF007H12- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMSF027K08- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF038D12+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF013D01- GAAGACATCTCTTACTCCG
JMFF022K23+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF023H05+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF013H21- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAN
JMFF016E13+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMFF011L13+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF016E13- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF011L13- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMSF016C17- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMSF016C17+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMFF014C21- GGAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMSF012O07+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMSF012O07- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
JMSF027K08+ GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
rJMSF010M21- GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
                      ____________________________________________________________
consensus GAAGACATCTCTTACTCCGATCCCTTCAAACACAACAAACTAATATTATATCTCTCCCAA
 
. : . : . : . : . : . :
rJMSF052O02- ACTATATTGTTGC
JMFF019P17+ ACTATATTGTTGCTT
rJMFF023H05- ACTATATTGTTGCTTGCATTC
JMFF048C23+ ACTATATTGTTGCTTGC
rJMFF048C23- ACTATATTGTTGCTTGC
rJMFF038F01- ACTATATTGTTGCTTGC
rJMFF051F01- ACTATATTGTTGCTT
JMFF051F01+ ACTATATTGT
JMFS002B05+ AC
JMFF007H12+ ACTATATTGTTGCTTGCATT
rJMSF041H11- ACTATATTGTTGCTTC
JMSF041H11+ ACTATATTGTTGCTTC
rJMFF022K23- ACTATATTGTTGCTT
rJMFF019P17- ACTATATTGTTGCTT
rJMSF018J13- ACTATATTGTTGCTTGCC
JMSF018J13+ ACTATATTGTTGCTTGCC
JMSF052O02+ ACTATATTGTTGC
JMFF013D01+ ACTATATTGTTGCTTGCAT
rJMFF038D20- ACTATATTGTTGCTTGCATT
JMFF038D20+ ACTATATTGTTGCTTGCATT
rJMFF023D19- ACTATATTGTTGC
JMFF023D19+ ACTATATTGTTGC
JMFF038F01+ ACTATATTGTTGCTTGC
rJMFF007H12- ACTATATTGTTGCTTGCATT
rJMSF027K08- ACTATATTGTTGCTTGCATTC
JMFF038D12+ ACTATATTGTTGCTTGCATT
JMFF022K23+ ACTATATTGTTGCTT
JMFF023H05+ ACTATATTGTTGCTTGCATTC
rJMFF013H21- ACTATATTGTTGCTTGCC
JMFF016E13+ ACTATATTGTTGCTT
JMFF011L13+ ACTATATTGTTGCTT
rJMFF016E13- ACTATATTGTTGCTT
rJMFF011L13- ACTATATTGTTGCTT
rJMSF016C17- ACTATATTGTTGCTTGCC
JMSF016C17+ ACTATATTGTTGCTTGCC
rJMFF014C21- ACTATATTGTTGCTTGC
JMSF012O07+ ACTATATTGTTGCTTC
rJMSF012O07- ACTATATTGTTGCTTC
JMSF027K08+ ACTATATTGTTGCTTGCATTC
rJMSF010M21- ACTATATTGTTGCTTGGGTTATGGAGGAAACTAGGATATACCATATATGCATACAAAGGG
                      ____________________________________________________________
consensus ACTATATTGTTGCTTGCATTCTGGAGGAAACTAGGATATACCATATATGCATACAAAGGG
 
. : . : . : . : . : . :
rJMSF010M21- CACTCATAAGCCCGATTAGGAGCCACAGAGCATCACAAGGTTCAAGCTAAGGTGCATAAA
                      ____________________________________________________________
consensus CACTCATAAGCCCGATTAGGAGCCACAGAGCATCACAAGGTTCAAGCTAAGGTGCATAAA
 
. : . : . : . : . : . :
rJMSF010M21- AGGAAAGCATTCCACTAACTCAGAACATAGCATACAATTACNAGACCTCGTGGTCTAGTG
                      ____________________________________________________________
consensus AGGAAAGCATTCCACTAACTCAGAACATAGCATACAATTACNAGACCTCGTGGTCTAGTG