Previous Contig 011586:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010K21Sequence280011586 (4)774011586 (4)gb:AP004764_18446351e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070
JMSF012L18Sequence472011586 (4)gb:AY045915_15614173e-26Arabidopsis thaliana unknown protein (At1g16060) mRNA, complete cds.>gb:AY133880682011586 (4)gb:AP004764_18446353e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010K21- GACCGGC
JMSF012L18- CCGGC
                      ____________________________________________________________
consensus GACCGGC
 
. : . : . : . : . : . :
JMSF010K21- TTCCTCCTCTGATCTGCCACTTTCCGATCGATCGGCCGCCCTGTCGGACCCATCTTTAAT
JMSF012L18- TTCCTCCTCTGATCTGCCACTTTCCGATCGATCGGCCGCCCTGTCGGACCCATCTTTAAT
                      ____________________________________________________________
consensus TTCCTCCTCTGATCTGCCACTTTCCGATCGATCGGCCGCCCTGTCGGACCCATCTTTAAT
 
. : . : . : . : . : . :
JMSF010K21- TTATTCTATCCCTTTTCATGTCTTAACTAAAAACACTACATACATATATACCCTTTCTCT
JMSF012L18- TTATTCTATCCCTTTTCATGTCTTAACTAAAAACACTACATACATATATACCCTTTCTCT
                      ____________________________________________________________
consensus TTATTCTATCCCTTTTCATGTCTTAACTAAAAACACTACATACATATATACCCTTTCTCT
 
. : . : . : . : . : . :
JMSF010K21- AACCCCGGCCGGCCGCCCCATTAGCAGAGTTAAACCAATTAATTTAATTAAGCTTCTCGA
JMSF012L18- AACCCCGGCCGGCCACCCCATTAGCAGAGTTAAACCAATTAATTTAATTAAGCTTCTCGA
                      ____________________________________________________________
consensus AACCCCGGCCGGCCGCCCCATTAGCAGAGTTAAACCAATTAATTTAATTAAGCTTCTCGA
 
. : . : . : . : . : . :
JMSF010K21- GCGAGCTCCATTAATGGCGAAAACCTCAAAAAAAGACAGCTCCCGCAGCGGCAGCAACGA
JMSF012L18- GCGAGCTCCATTAATGGCGAAAACCTCGAAAAAAGACAGCTCCCGCAGCGGCAGCAACGA
                      ____________________________________________________________
consensus GCGAGCTCCATTAATGGCGAAAACCTCGAAAAAAGACAGCTCCCGCAGCGGCAGCAACGA
 
. : . : . : . : . : . :
JMSF010K21- CGATNACGTTGTTAAGGTGAAAAGAACTCGTAA
JMSF012L18- CGATTACGTTGTTAAGGTGAAAAGAACTCGTAAAAGCGTGCCCAGAGACTCTCCTCCTCA
                      ____________________________________________________________
consensus CGATTACGTTGTTAAGGTGAAAAGAACTCGTAAAAGCGTGCCCAGAGACTCTCCTCCTCA
 
. : . : . : . : . : . :
JMSF012L18- ACGAAGCTCCGTTTTCCGAGGTGTCACCAGGCACCGGTGGACCGGCCGATATGAAGCTCA
                      ____________________________________________________________
consensus ACGAAGCTCCGTTTTCCGAGGTGTCACCAGGCACCGGTGGACCGGCCGATATGAAGCTCA
 
. : . : . : . : . : . :
JMSF012L18- TCTATGGGATAAGAACAGCTGGAATGAAGCACAGAGTAAGAAAGGAAGACAAGTATATTT
rJMSF012L18+ TT
                      ____________________________________________________________
consensus TCTATGGGATAAGAACAGCTGGAATGAAGCACAGAGTAAGAAAGGAAGACAAGTATATTT
 
. : . : . : . : . : . :
JMSF012L18- GGGGGCTTATGATGATGAAGAAGCAGCAGCACATGCATATGACTT
rJMSF012L18+ GGGGGCTTATGATGATGAAGAAGCAGCAGCACATGCATATGACTTGGCAGCATTGAAGTA
rJMSF010K21+ TTATGATGATGNAGAAGCAGCAGCACATGCATATGACTTGGCAGCATTGAAGTA
                      ____________________________________________________________
consensus GGGGGCTTATGATGATGAAGAAGCAGCAGCACATGCATATGACTTGGCAGCATTGAAGTA
 
. : . : . : . : . : . :
rJMSF012L18+ TTGGGGACAAGAGACAATCCTAAATTTCCCACTTGCTACTTATGAAAAAGAGNTAAAGGA
rJMSF010K21+ TTGGGGACAAGAGACAATCCTAAATTTCCCACTTGCTACTTATGAAAAAGAGCTAAAGGA
                      ____________________________________________________________
consensus TTGGGGACAAGAGACAATCCTAAATTTCCCACTTGCTACTTATGAAAAAGAGCTAAAGGA
 
. : . : . : . : . : . :
rJMSF012L18+ AATGGAAGGTCAATCAAAAGAAGAGTATATTGGTTCTTTGAGAAGAAAGAGCAGTGGATT
rJMSF010K21+ AATGGAAGGTCAATCAAAAGAAGAGTATATTGGTTCTTTGAGAAGAAAGAGCAGTGGATT
                      ____________________________________________________________
consensus AATGGAAGGTCAATCAAAAGAAGAGTATATTGGTTCTTTGAGAAGAAAGAGCAGTGGATT
 
. : . : . : . : . : . :
rJMSF012L18+ TTCTAGGGGTGTCTCGAAATACAGAGGAGTAGCAAGACACCATCACAATGGAAGATGGGA
rJMSF010K21+ TTCTAGGGGTGTCTCGAAATACAGAGGAGTAGCAAGACACCATCACAATGGAAGATGGGA
                      ____________________________________________________________
consensus TTCTAGGGGTGTCTCGAAATACAGAGGAGTAGCAAGACACCATCACAATGGAAGATGGGA
 
. : . : . : . : . : . :
rJMSF012L18+ GGCTCGCATTGGAAGGGTGTTTGGCAACAAATATCTCTACCTTGGAACTTATGCTACTCA
rJMSF010K21+ GGCTCGCATTGGAAGGGTGTTTGGCAACAAATATCTCTACCTTGGGACTTATGCTACTCA
                      ____________________________________________________________
consensus GGCTCGCATTGGAAGGGTGTTTGGCAACAAATATCTCTACCTTGGGACTTATGCTACTCA
 
. : . : . : . : . : . :
rJMSF012L18+ AGAGGAAGCGGCAACGGCTTATGACATGGCAGCCATAGAGTACCGTGGGCTTAACGCCGT
rJMSF010K21+ AGAGGAAGCGGCAACGGCTTATGACATGGCAGCCATAGAGTACCGTGGGCTTAACGCCGT
                      ____________________________________________________________
consensus AGAGGAAGCGGCAACGGCTTATGACATGGCAGCCATAGAGTACCGTGGGCTTAACGCCGT
 
. : . : . : . : . : . :
rJMSF012L18+ CACCAATTTTGACCTCAGCCGTTACGTCAAGTGGCTACGCCCTGATGATCAAAACCCTAA
rJMSF010K21+ CACCAATTTTGACCTCAGCCGTTACGTCAAGTGGCTACGCCCTGATGATCAAAACCCTAA
                      ____________________________________________________________
consensus CACCAATTTTGACCTCAGCCGTTACGTCAAGTGGCTACGCCCTGATGATCAAAACCCTAA
 
. : . : . : . : . : . :
rJMSF012L18+ CAACCTTCAGCCAAACCCTAACCCTAGTAATGACGCCGTTAGTCATCATCATGATGAACT
rJMSF010K21+ CAACCTTCAGCCAAACCCTAACCCTAGTAATGACGCCGTTAGTCATCATCATGATGAACT
                      ____________________________________________________________
consensus CAACCTTCAGCCAAACCCTAACCCTAGTAATGACGCCGTTAGTCATCATCATGATGAACT
 
. : . : . : . : . : . :
rJMSF012L18+ CATCATCACCACCCAGCAACAGCAGCAGCCGCAACAAAGCTCCGGCGGTTCATCGGAAAC
rJMSF010K21+ CATCATCACCACCCAGCAACAGCAGCAGCCGCAACAAAGCTCCGGCGGTTCATCGGAAAC
                      ____________________________________________________________
consensus CATCATCACCACCCAGCAACAGCAGCAGCCGCAACAAAGCTCCGGCGGTTCATCGGAAAC
 
. : . : . : . : . : . :
rJMSF012L18+ GGCCTCTCCTCCGCCGCATGACCCCTCCGCCGCCTCCGCCACTTCGTCGGCATCTACCAA
rJMSF010K21+ GGCCTCTCCTCCGCCGCATGACCCCTCCGCCGCCTCCGCCACTTCGTCGGCATCTACCAA
                      ____________________________________________________________
consensus GGCCTCTCCTCCGCCGCATGACCCCTCCGCCGCCTCCGCCACTTCGTCGGCATCTACCAA
 
. : . : . : . : . : . :
rJMSF012L18+ CTTTCCAACCACCCCGCCGGAGCCGGAGCTGGAGCCGGACCGACCGAGAAGANGTTTNCC
rJMSF010K21+ CTTTCCAACCACCCCGCCGGAGCCGGAGCTGGAGCCGGACCGACCGAGAAGAAGTTTCCC
                      ____________________________________________________________
consensus CTTTCCAACCACCCCGCCGGAGCCGGAGCTGGAGCCGGACCGACCGAGAAGAAGTTTCCC
 
. : . : . : . : . : . :
rJMSF012L18+ GGACGACNTACAAACGTACT
rJMSF010K21+ GGACGACATACAAACGTACTTTGACTGCGACGACTCGAGTAGCTTTGTGGAGGAGCATGA
                      ____________________________________________________________
consensus GGACGACATACAAACGTACTTTGACTGCGACGACTCGAGTAGCTTTGTGGAGGAGCATGA
 
. : . : . : . : . : . :
rJMSF010K21+ CATCATCTTTGGTGACCTAAGCTCATTTGATTCATCCATGTTTCATTGTGAGCTTGATGC
                      ____________________________________________________________
consensus CATCATCTTTGGTGACCTAAGCTCATTTGATTCATCCATGTTTCATTGTGAGCTTGATGC