Previous Contig 011585:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010K12Sequence321011585 (2)pir|B84562|B845624e-22hypothetical protein At2g18250 [imported] - Arabidopsis thaliana>gb:AC006439_153657011585 (2)pir|B84562|B845624e-64hypothetical protein At2g18250 [imported] - Arabidopsis thaliana>gb:AC006439_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010K12- GATCTGCTTTCCTGCC
                      ____________________________________________________________
consensus GATCTGCTTTCCTGCC
 
. : . : . : . : . : . :
JMSF010K12- AACTAACCTTCTACTAACCAACCCAACTTCAGTTGGTTACTTCTCTTTTCTCTTGAAACA
                      ____________________________________________________________
consensus AACTAACCTTCTACTAACCAACCCAACTTCAGTTGGTTACTTCTCTTTTCTCTTGAAACA
 
. : . : . : . : . : . :
JMSF010K12- CAGCAATCATAGCCGCCCCAATGGCGATAATGGAAGAGCAATCGGCGATCAACTCAACCT
                      ____________________________________________________________
consensus CAGCAATCATAGCCGCCCCAATGGCGATAATGGAAGAGCAATCGGCGATCAACTCAACCT
 
. : . : . : . : . : . :
JMSF010K12- CGTCTCCGCTAGATTCATACGCCGCGGTGGTTCTCGGCGGCACTTTCGACCGCTTACACG
rJMSF010K12+ CTCCGCTAGATTCATACGCCGCGGTGGTTCTCGGCGGCACTTTCGACCGCTTACACG
                      ____________________________________________________________
consensus CGTCTCCGCTAGATTCATACGCCGCGGTGGTTCTCGGCGGCACTTTCGACCGCTTACACG
 
. : . : . : . : . : . :
JMSF010K12- ACGGCCACCGCCTCTTCCTCAAGGCTGCGGCCGAGTTGTCCCGGGAACGAGTCGTAGTTG
rJMSF010K12+ ACGGCCACCGCCTCTTCCTCAAGGCTGCGGCCGAGTTGTCCCGGGAACGAGTCGTAGTTG
                      ____________________________________________________________
consensus ACGGCCACCGCCTCTTCCTCAAGGCTGCGGCCGAGTTGTCCCGGGAACGAGTCGTAGTTG
 
. : . : . : . : . : . :
JMSF010K12- GTGTTTGCGCTGGCCCAATGTTGACCAAGAAGAAGTATGCTGATTTAATAGAGCCAATTG
rJMSF010K12+ GTGTTTGCGCTGGCCCAATGTTGACCAAGAAGAAGTATGCTGATTTAATAGAGCCAATTG
                      ____________________________________________________________
consensus GTGTTTGCGCTGGCCCAATGTTGACCAAGAAGAAGTATGCTGATTTAATAGAGCCAATTG
 
. : . : . : . : . : . :
JMSF010K12- AGCAA
rJMSF010K12+ AGCAAAGAATGCAAAATGTTGAAAATTACATTAAGAGCATCAAGGCAGAGCTGGTTGTAC
                      ____________________________________________________________
consensus AGCAAAGAATGCAAAATGTTGAAAATTACATTAAGAGCATCAAGGCAGAGCTGGTTGTAC
 
. : . : . : . : . : . :
rJMSF010K12+ AAGCAGATCCGATTGTCAATCCTTATGGTCCTTCAATCATTGATGAGAATTTGGAGGCTA
                      ____________________________________________________________
consensus AAGCAGATCCGATTGTCAATCCTTATGGTCCTTCAATCATTGATGAGAATTTGGAGGCTA
 
. : . : . : . : . : . :
rJMSF010K12+ TTGTAGTCAGCAAGGAGACATTACCCGGTGGATTATCTGTCAATAAGAAGAGGGCTGAGA
                      ____________________________________________________________
consensus TTGTAGTCAGCAAGGAGACATTACCCGGTGGATTATCTGTCAATAAGAAGAGGGCTGAGA
 
. : . : . : . : . : . :
rJMSF010K12+ GAGGTCTTTCACAACTAAAGATTGAAGTTGTAGATCTACTCTCTGAAGAATCGAGCGGAG
                      ____________________________________________________________
consensus GAGGTCTTTCACAACTAAAGATTGAAGTTGTAGATCTACTCTCTGAAGAATCGAGCGGAG
 
. : . : . : . : . : . :
rJMSF010K12+ ACAAACTGAGTTCCACTGCTTTGAGAGAGCTAGAAGCCAAGAAGCTCACGAACACTCGCC
                      ____________________________________________________________
consensus ACAAACTGAGTTCCACTGCTTTGAGAGAGCTAGAAGCCAAGAAGCTCACGAACACTCGCC
 
. : . : . : . : . : . :
rJMSF010K12+ CAGAAGGTGGTATGAACTCGTGACATCATTCCATGGAAGATAGAACAATATCATTACAAT
                      ____________________________________________________________
consensus CAGAAGGTGGTATGAACTCGTGACATCATTCCATGGAAGATAGAACAATATCATTACAAT
 
. : . : . : . : . : . :
rJMSF010K12+ AAACTTATTTTCCAGAAACTACATTCAATCAATCATCTCGAGGCAACATCTTTGCTCTTA
                      ____________________________________________________________
consensus AAACTTATTTTCCAGAAACTACATTCAATCAATCATCTCGAGGCAACATCTTTGCTCTTA
 
. : . : . : . : . : . :
rJMSF010K12+ CCTGAAAGCTTTTTTGCTTGGAGGACAACCACAGAACCACCAGTATCATGTATGGAAATG
                      ____________________________________________________________
consensus CCTGAAAGCTTTTTTGCTTGGAGGACAACCACAGAACCACCAGTATCATGTATGGAAATG