Previous Contig 011578:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039G02Sequence583011578 (7)gb:AY054564_15632184e-18Arabidopsis thaliana putative protein (At4g26370; M3E9.200) mRNA, complete cds.>
JMSF008C18Sequence286011578 (7)601011578 (7)gb:AY054564_15632181e-04Arabidopsis thaliana putative protein (At4g26370; M3E9.200) mRNA, complete cds.>
JMSF010I15Sequence347011578 (7)346011578 (7)gb:HSU63332_20253715e-10Human super cysteine rich protein mRNA, partial cds.
JMSF033I03Sequence672011578 (7)gb:AY054564_15632181e-44Arabidopsis thaliana putative protein (At4g26370; M3E9.200) mRNA, complete cds.>660011578 (7)gb:AY054564_15632186e-28Arabidopsis thaliana putative protein (At4g26370; M3E9.200) mRNA, complete cds.>

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010I15- CAATTTACTCC
                      ____________________________________________________________
consensus CAATTTACTCC
 
. : . : . : . : . : . :
JMSF008C18- ACCGGTAATACATTAGTCCGCGAATGTTATCCACAACGGTTTCAAACTCCA
JMSF010I15- TCGGAAAGCACCGGTAATACATTAGTCCGCGAATGTTATCCACAACGGTTTCAAACTCCA
JMSF033I03- GGTTTCAAACTCCA
                      ____________________________________________________________
consensus TCGGAAAGCACCGGTAATACATTAGTCCGCGAATGTTATCCACAACGGTTTCAAACTCCA
 
. : . : . : . : . : . :
JMSF008C18- GTCTGCACTGCCTTCCGCTGTAATCAATCCCGGAGAAGAAGCGGAGCAAATGCCGGCGGC
JMSF010I15- GTCTGCACTGCCTTCCGCTGTAATCAATCCCGGAGAAGAAGCGGAGCAAATGCCGGCGGC
JMSF033I03- GTCTGCACTGCCTTCCGCTGTAATCAATCCCGGAGAAGAAGCGGAGCAAATGCCGGCGGC
                      ____________________________________________________________
consensus GTCTGCACTGCCTTCCGCTGTAATCAATCCCGGAGAAGAAGCGGAGCAAATGCCGGCGGC
 
. : . : . : . : . : . :
JMSF008C18- GACTTCCTTTCTCAGCTCTTCGGCCGGAGCTTCGCACCTCCCCTTCTCCCTCGTAGTAAT
JMSF010I15- GACTTCCTTTCTCAGCTCTTCGGCCGGAGCTTCGCACCTCCCCTTCTCCCTCGTAGTAAT
JMSF033I03- GACTTCCTTTCTCAGCTCTTCGGCCGGAGCTTCGCACCTCCCCTTCTCCCTCGTAGTAAT
                      ____________________________________________________________
consensus GACTTCCTTTCTCAGCTCTTCGGCCGGAGCTTCGCACCTCCCCTTCTCCCTCGTAGTAAT
 
. : . : . : . : . : . :
JMSF008C18- CTCTTCTTCTTCTTCTTCCTCCACCCTAAAACCCCACGTGGGGTTTATCTTCAATTCACT
JMSF010I15- CTCTTCTTCTTCTTCTTCCTCCACCCTAAAACCCCACGTGGGGTTTATCTTCAATTCACT
JMSF033I03- CTCTTCTTCTTCTTCTTCCTCCACCCTAAAACCCCACGTGGGGTTTATCTTCAATTCACT
                      ____________________________________________________________
consensus CTCTTCTTCTTCTTCTTCCTCCACCCTAAAACCCCACGTGGGGTTTATCTTCAATTCACT
 
. : . : . : . : . : . :
JMSF008C18- CCCGAAATGCCCACCCCGCTTGCTCTTCTCTTCCCCCCACGCCGCCACCG
JMSF010I15- CCCGAAATGCCCACCCCGCTTGCTCTTCTCTTCCCCCCACGCCGCCACCGCCGGNAGAAC
JMSF033I03- CCCGAAATGCCCACCCCGCTTGCTCTTCTCTTCCCCCCACGCCGCCACCGCCGGCAGAAC
                      ____________________________________________________________
consensus CCCGAAATGCCCACCCCGCTTGCTCTTCTCTTCCCCCCACGCCGCCACCGCCGGCAGAAC
 
. : . : . : . : . : . :
JMSF010I15- CTCTCTCCTCCTCCGCCCCTCGGCTCTCGNCGTCGA
JMSF033I03- CTCTCTCCTCCTCCGCCCCTCGGCTCTCGCCGTCGACGACGCTCTTGGGCAGTCCGCCGA
                      ____________________________________________________________
consensus CTCTCTCCTCCTCCGCCCCTCGGCTCTCGCCGTCGACGACGCTCTTGGGCAGTCCGCCGA
 
. : . : . : . : . : . :
JMSF033I03- TACGTTCTCGGTGCAGCCCAAGATTGACAAGAGCGGGAGATTTTGCAGCCCCAGGGCGGC
                      ____________________________________________________________
consensus TACGTTCTCGGTGCAGCCCAAGATTGACAAGAGCGGGAGATTTTGCAGCCCCAGGGCGGC
 
. : . : . : . : . : . :
JMSF033I03- CCGGGAGCTTGCTCTAATGACTCTCTACGCCTCGTGTCTAGAAGGGACTGATCCCGTAAG
                      ____________________________________________________________
consensus CCGGGAGCTTGCTCTAATGACTCTCTACGCCTCGTGTCTAGAAGGGACTGATCCCGTAAG
 
. : . : . : . : . : . :
JMSF033I03- GCTTTTCGAGAAGAGGTTGACCATTAGAAGAGAACCTGGCTATGAATTTGATAAAGAGTG
                      ____________________________________________________________
consensus GCTTTTCGAGAAGAGGTTGACCATTAGAAGAGAACCTGGCTATGAATTTGATAAAGAGTG
 
. : . : . : . : . : . :
JMSF033I03- TTTAATGAAATATAACCATATGAGCTTTGGAGGGCCACCGGTGACAACCGAGACACTGGA
                      ____________________________________________________________
consensus TTTAATGAAATATAACCATATGAGCTTTGGAGGGCCACCGGTGACAACCGAGACACTGGA
 
. : . : . : . : . : . :
JMSF033I03- GGAAGCTGATCAGCTTGAGCTCAGTGATGAAAAGGAGTCTGAAGTTGAAGCAGAAGTTCT
rJMSF033I03+ AGTGATGAAAAGGAGTNTGAAGTTGAAGCAGAAGTTNT
                      ____________________________________________________________
consensus GGAAGCTGATCAGCTTGAGCTCAGTGATGAAAAGGAGTCTGAAGTTGAAGCAGAAGTTCT
 
. : . : . : . : . : . :
JMSF033I03- TTCAGCACCCCCGAAGTTAGTTTACAGCAAACTAATTTTACGCTTCACCCGGAA
rJMSF033I03+ TTCAGCNCCCCCGAAGTTAGTTTACNGCAAACTAATTTTNCGCTTCCCCCGGAAACTTTT
                      ____________________________________________________________
consensus TTCAGCACCCCCGAAGTTAGTTTACAGCAAACTAATTTTACGCTTCCCCCGGAAACTTTT
 
. : . : . : . : . : . :
rJMSF033I03+ GGTTGCAGTTGCCGAGAAATGGGACNGTCATGTGCTNGTAANTGATAAAGTTGCCCCTCN
                      ____________________________________________________________
consensus GGTTGCAGTTGCCGAGAAATGGGACNGTCATGTGCTNGTAANTGATAAAGTTGCCCCTCN
 
. : . : . : . : . : . :
rJMSF033I03+ CAATTGGAAGAGTGAACCGGCTGGAAGAATNTTGGAACTTTNGATTNTTCNTTTGGCAAN
                      ____________________________________________________________
consensus CAATTGGAAGAGTGAACCGGCTGGAAGAATNTTGGAACTTTNGATTNTTCNTTTGGCAAN
 
. : . : . : . : . : . :
rJMSF033I03+ GTTTGAAATTGCNGTGGNGGGAACTNGGCCCCAAATAGTTNTCAACGNGGCGGTAGATNT
rJMSF008C18+ GGCGGTAGATNT
rJMFF039G02+ GGTAGATNT
                      ____________________________________________________________
consensus GTTTGAAATTGCNGTGGNGGGAACTNGGCCCCAAATAGTTNTCAACGNGGCGGTAGATNT
 
. : . : . : . : . : . :
rJMSF033I03+ TGCAAAACGGTTNTGTGATGGGGCAGCNCCTNGTATCATCAACGGTTGCCTCNGGACNTT
rJMSF008C18+ TGCAAAACGGTTNTGTGATGGGGCAGCNCCTNGTATCATCAACGGTTGCCTCNGGACNTT
rJMFF039G02+ TGCAAAACGGTTTTGNGATGGGGCAGCCCCTTGTNTCATCAACGGNTNCCTCAGGACATT
                      ____________________________________________________________
consensus TGCAAAACGGTTTTGTGATGGGGCAGCCCCTTGTATCATCAACGGTTGCCTCAGGACATT
 
. : . : . : . : . : . :
rJMSF033I03+ TGTCAACGATNTNGGGGGAACTAGCGCTGGCCGAATAACAAACTCNAGCGTTAAGCCGTC
rJMSF008C18+ TGTCAACGATNT-CGGGGAACTAGCGCTGGCCGAATAACAAACTCNAGCGTTAAGCCGTC
rJMFF039G02+ TGTCAACGATTTNGGGGGAACTAGCNCTGGCCGAATAACAAACTCAAGCGTTAAGCNGTC
                      ____________________________________________________________
consensus TGTCAACGATTTNGGGGGAACTAGCGCTGGCCGAATAACAAACTCAAGCGTTAAGCCGTC
 
. : . : . : . : . : . :
rJMSF033I03+ GGTTTTTACCTAGATGCNTTGTCGNGGTCAAGGTNTTCNCCTAACNCCGTGTTGCTGAGT
rJMSF008C18+ GGTTTTTACCNAGATGCNTTGTCGNGGTCAAGGTNTTCNCCNAACNCCGTGTTGCTGAGT
rJMFF039G02+ GGTTTTTNCCTAGANGCNTTGTNGAGGTCAAGGTTTTCNCCTAACNCCGTGTTGCTGAGT
                      ____________________________________________________________
consensus GGTTTTTACCTAGATGCNTTGTCGAGGTCAAGGTTTTCNCCTAACNCCGTGTTGCTGAGT
 
. : . : . : . : . : . :
rJMSF033I03+ GAGCTGTAGCCGTCGAGAGAGAGAGCGCTTATTNTNTCGGGCCNTTTTTACGTAAAGCCC
rJMSF008C18+ GAGCNGTAGCCGTCGAGAGAGAGAGCGCTTATTCTCTCGGGCCNTTTTTACGTAAAGCCC
rJMFF039G02+ GAGCTGTANCNNTNGAGAGAGAGANCGCTTATTNTNTCGGGCCATTTTTNCGTAAANCCN
                      ____________________________________________________________
consensus GAGCTGTAGCCGTCGAGAGAGAGAGCGCTTATTCTCTCGGGCCATTTTTACGTAAAGCCC
 
. : . : . : . : . : . :
rJMSF033I03+ TGGAAGGGCNTGCCGGAATGAAATTNTTGGNGCCNTAACCGGCGATTGCGAGGCGGGGCA
rJMSF008C18+ TGGAAGGGCNTGCCGGAATGAAATTNTTGGNGCCNTAACCGGCGATTGCGNGGCGGGGCA
rJMFF039G02+ TGGAAGGGCANGCCGGAANGAAATTTTTGGNGCCATAACAGGNGATTGNGAGGCGGGGCA
rJMSF010I15+ A
                      ____________________________________________________________
consensus TGGAAGGGCATGCCGGAATGAAATTTTTGGNGCCATAACCGGCGATTGCGAGGCGGGGCA
 
. : . : . : . : . : . :
rJMSF033I03+ AAAAAAAAAAATTATATGTTGAATATAGAGAGCAAGTGTTGTATATGATGATAATGCCCT
rJMSF008C18+ AAAAAAAAAAATTATATGTTGAATATAGAGAGCAAGTGTTGTATATGATGATAATGCCCT
rJMFF039G02+ AAAAAAAAAAATTATATGTTGAATATAGAGAGCAAGTGTTGTATATGATGATAATGCCCT
rJMSF010I15+ AAAAAAAAAAATTATATGTTGAATATAGAGAGCAAGTGTTGTATATGATGATAATGCCCT
                      ____________________________________________________________
consensus AAAAAAAAAAATTATATGTTGAATATAGAGAGCAAGTGTTGTATATGATGATAATGCCCT
 
. : . : . : . : . : . :
rJMSF033I03+ GCTAATACCTGGCTATTGAAAC
rJMSF008C18+ GCTAATA-CTGGCTATTGAAACTGGGATTTTTATGATC
rJMFF039G02+ GCTAATA-CTGGCTATTGAAACTGGGATTTTTATGATCAATGTTGAATTTCATAGGAACA
rJMSF010I15+ GCTAATA-CTGGCTATTGAAACTGGGATTTTTATGATCAATGTTGAATTTCATAGGAACA
                      ____________________________________________________________
consensus GCTAATA-CTGGCTATTGAAACTGGGATTTTTATGATCAATGTTGAATTTCATAGGAACA
 
. : . : . : . : . : . :
rJMFF039G02+ TTGGATAAT
rJMSF010I15+ TTGGATAATTGAAGATTTGAAGTGTATTGTTGTTGTGTGTTCTGCTGTCTAAGTAGATAT
                      ____________________________________________________________
consensus TTGGATAATTGAAGATTTGAAGTGTATTGTTGTTGTGTGTTCTGCTGTCTAAGTAGATAT
 
. : . : . : . : . : . :
rJMSF010I15+ ATACAGCTATATCAAGTGATTTCTTCTGTTTTTGCTTTTACCTGTATCTTACTAAACATT
                      ____________________________________________________________
consensus ATACAGCTATATCAAGTGATTTCTTCTGTTTTTGCTTTTACCTGTATCTTACTAAACATT