Previous Contig 011567:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010F20Sequence424011567 (2)pir|B84595|B845951e-13hypothetical protein At2g20940 [imported] - Arabidopsis thaliana>gb:AC006234_153681011567 (2)gb:AP006149_18609731e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B127

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010F20- GAGGTAAGCCCACATAAATTT
rJMSF010F20+ GAGGTAAGCCCACATAAATTT
                      ____________________________________________________________
consensus GAGGTAAGCCCACATAAATTT
 
. : . : . : . : . : . :
JMSF010F20- CTTTAAAAGAAAGCGCGCCGCCGGCTTAGTACAATCTTCTCCATCTCCAGCCTTGGTCAA
rJMSF010F20+ CTTTAAAAGAAAGCGCGCCGCCGGCTTAGTACAATCTTCTCCATCTCCAGCCTTGGTCAA
                      ____________________________________________________________
consensus CTTTAAAAGAAAGCGCGCCGCCGGCTTAGTACAATCTTCTCCATCTCCAGCCTTGGTCAA
 
. : . : . : . : . : . :
JMSF010F20- AAGCTAGCGTCTTCTTCTGTTGTGTGGAACTTCAAAACCCTAGCGCAAAACCCTCATCCA
rJMSF010F20+ AAGCTAGCGTCTTCTTCTGTTGTGTGGAACTTCAAAACCCTAGCGCAAAACCCTCATCCA
                      ____________________________________________________________
consensus AAGCTAGCGTCTTCTTCTGTTGTGTGGAACTTCAAAACCCTAGCGCAAAACCCTCATCCA
 
. : . : . : . : . : . :
JMSF010F20- CTCTATACTAGTCAGATTATATAGATATATAGACAAGAAAAATGTTTGGAGGGAGACTGA
rJMSF010F20+ CTCTATACTAGTCAGATTATATAGATATATAGACAAGAAAAATGTTTGGAGGGAGACTGA
                      ____________________________________________________________
consensus CTCTATACTAGTCAGATTATATAGATATATAGACAAGAAAAATGTTTGGAGGGAGACTGA
 
. : . : . : . : . : . :
JMSF010F20- AAGAGCTGTTGAAGAAGTATGGAAAAGTAGGATTGGGGGTTCACTTCTCAGTGTCGGCGG
rJMSF010F20+ AAGAGCTGTTGAAGAAGTATGGAAAAGTAGGATTGGGGGTTCACTTCTCAGTGTCGGCGG
                      ____________________________________________________________
consensus AAGAGCTGTTGAAGAAGTATGGAAAAGTAGGATTGGGGGTTCACTTCTCAGTGTCGGCGG
 
. : . : . : . : . : . :
JMSF010F20- CCTCCATCACCGGCCTTTATGTAGCCATCAAGAACAATGTGGACGTGGAGTCCATGCTCG
rJMSF010F20+ CCTCCATCACCGGCCTTTATGTAGCCATCAAGAACAATGTGGACGTGGAGTCCATGCTCG
                      ____________________________________________________________
consensus CCTCCATCACCGGCCTTTATGTAGCCATCAAGAACAATGTGGACGTGGAGTCCATGCTCG
 
. : . : . : . : . : . :
JMSF010F20- AGAAAGTGGGGATGCCCAGCCTCGCCAAACCCAACGAACAAGAATTCCCGTCGCAAAACC
rJMSF010F20+ AGAAAGTGGGGATGCCCAGCCTCGCCAAACCCAACGAACAAGAATTCCCGTCGCAAAACC
                      ____________________________________________________________
consensus AGAAAGTGGGGATGCCCAGCCTCGCCAAACCCAACGAACAAGAATTCCCGTCGCAAAACC
 
. : . : . : . : . : . :
JMSF010F20- CGGAACTGATCAGCGATGACCCGATTCGAGACCCACCGAAGAT
rJMSF010F20+ CGGAACTGATCAGCGATGACCCGATTCGAGACCCACCGAAGATTAGGAATCGGACGGCTG
                      ____________________________________________________________
consensus CGGAACTGATCAGCGATGACCCGATTCGAGACCCACCGAAGATTAGGAATCGGACGGCTG
 
. : . : . : . : . : . :
rJMSF010F20+ AGCTGGTGGCTTCCACCGGCGGCGCCCTCACTCTCGCCGTCCTGCTCAACAAAGCCCTGT
                      ____________________________________________________________
consensus AGCTGGTGGCTTCCACCGGCGGCGCCCTCACTCTCGCCGTCCTGCTCAACAAAGCCCTGT
 
. : . : . : . : . : . :
rJMSF010F20+ TTCCCGTCCGGGTTCCGATCACAATCGCTCTTACTCCCCCGATCGCCAGGTTTCTTGCAA
                      ____________________________________________________________
consensus TTCCCGTCCGGGTTCCGATCACAATCGCTCTTACTCCCCCGATCGCCAGGTTTCTTGCAA
 
. : . : . : . : . : . :
rJMSF010F20+ GACGGAATATTATCAAGAATAGTGTATGATCTTTTTGTTTAATTTGTATCCTTCTTTTCT
                      ____________________________________________________________
consensus GACGGAATATTATCAAGAATAGTGTATGATCTTTTTGTTTAATTTGTATCCTTCTTTTCT
 
. : . : . : . : . : . :
rJMSF010F20+ TCCTTTTAATTAATAATGTCAGTCTGATAGCGTATACTGATTGGTTGTACGAACCATGAT
                      ____________________________________________________________
consensus TCCTTTTAATTAATAATGTCAGTCTGATAGCGTATACTGATTGGTTGTACGAACCATGAT