Previous Contig 011564:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010F11Sequence355007140 (2)775011564 (2)gb:AC130611_17408871e-42Oryza sativa (japonica cultivar-group) chromosome 5 clone P0483D07, complete seq
JMSF037D22Sequence666007140 (2)gb:AY074295_15674549e-43Arabidopsis thaliana unknown protein (At4g34020) mRNA, complete cds.>gb:AY096711694011564 (2)gb:AC130611_17408875e-34Oryza sativa (japonica cultivar-group) chromosome 5 clone P0483D07, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010F11+ GGGCAAAGGTCAATGTTGTGGTAGCATCGGGTGAAAAATNTGCAGTAATCTTGGC
                      ____________________________________________________________
consensus GGGCAAAGGTCAATGTTGTGGTAGCATCGGGTGAAAAATNTGCAGTAATCTTGGC
 
. : . : . : . : . : . :
rJMSF037D22+ GGCAGACAAGTTGANTGACAGTGCAGCTGAGTCGATGTA
rJMSF010F11+ ATCAAAAGGCGTTAAGATTGTGGCAGACAAGTTGATTGACAGTGCAGCTGAGTCGATGTA
                      ____________________________________________________________
consensus ATCAAAAGGCGTTAAGATTGTGGCAGACAAGTTGATTGACAGTGCAGCTGAGTCGATGTA
 
. : . : . : . : . : . :
rJMSF037D22+ TGATNTGATAATCCTGCCGTGAGGAGAAGTTGGAGTTCAGCGGCTTCAAAGGTCGAGAAC
rJMSF010F11+ TGATCTGATAATCCTGCCGGGAGGAGAAGTTGGAGTTCAGCGGCTTCAAAGGTCGAGAAC
                      ____________________________________________________________
consensus TGATCTGATAATCCTGCCGTGAGGAGAAGTTGGAGTTCAGCGGCTTCAAAGGTCGAGAAC
 
. : . : . : . : . : . :
rJMSF037D22+ TCTGAAGAAGTTGCTAAAGGAACAAGAATCGGGTGGAAGAACATTTGGTGCCATGTGCTC
rJMSF010F11+ TCTGAAGAAGTTGCTAAAGGAACAAGAATCGGGTGGAAGAACATTTGGTGCCATGTGCTC
                      ____________________________________________________________
consensus TCTGAAGAAGTTGCTAAAGGAACAAGAATCGGGTGGAAGAACATTTGGTGCCATGTGCTC
 
. : . : . : . : . : . :
rJMSF037D22+ TTCATCACCTATAATACTGCAGAAACAGGGTTTGCTCAAGGCCAAAAAATCCGCTGCTCA
rJMSF010F11+ TTCATCACCTATAATACTGCAGAAACAGGGTTTGCTCAAGGCCAAAAAATCCGCTGCTCA
                      ____________________________________________________________
consensus TTCATCACCTATAATACTGCAGAAACAGGGTTTGCTCAAGGCCAAAAAATCCGCTGCTCA
 
. : . : . : . : . : . :
rJMSF037D22+ TCCCTCCATCGCCATGAGCAAGCTCGACGATGTTCCAAATGGTGCCCGGGTAGTTGTTGA
rJMSF010F11+ TCCCTCCATCGCCATGAGCAAGCTCGACGATGTTCCAAATGGTGCCCGGGTAGTTGTTGA
                      ____________________________________________________________
consensus TCCCTCCATCGCCATGAGCAAGCTCGACGATGTTCCAAATGGTGCCCGGGTAGTTGTTGA
 
. : . : . : . : . : . :
rJMSF037D22+ TGGTAAACTGATCACAAGCAAAGGGCTTTCTACTGCAATAGAATTTGGACTGGCCATTGT
rJMSF010F11+ TGGTAAACTGATCACAAGCAAAGGGCTTTCTACTGCAATAGAATTTGGACTGGCCATTGT
                      ____________________________________________________________
consensus TGGTAAACTGATCACAAGCAAAGGGCTTTCTACTGCAATAGAATTTGGACTGGCCATTGT
 
. : . : . : . : . : . :
rJMSF037D22+ AAGCAAGTTCTTCGGGCATGCAAGAGCGAGGAGCGTAGCAGAAGGTCTTGTTTTTGAGTA
rJMSF010F11+ AAGCAAGTTCTTCGGGCATGCAAGAGCGAGGAGCGTAGCAGAAGGTCTTGTTTTTGAGTA
                      ____________________________________________________________
consensus AAGCAAGTTCTTCGGGCATGCAAGAGCGAGGAGCGTAGCAGAAGGTCTTGTTTTTGAGTA
 
. : . : . : . : . : . :
rJMSF037D22+ CCCGAGGAACTAAGAATTCCAGTTCTTTAGCAGCAAAACCGTAAATGCCACTCAACAAGG
rJMSF010F11+ CCCGAGGAACTAAGAATTCCAGTTCTTTAGCAGCAAAACCGTAAATGCCACTCAACAAGG
                      ____________________________________________________________
consensus CCCGAGGAACTAAGAATTCCAGTTCTTTAGCAGCAAAACCGTAAATGCCACTCAACAAGG
 
. : . : . : . : . : . :
rJMSF037D22+ CGCTCTCGAGGTCACTAAAGAAGATCAATCTAGCAACAGCGGCAACAACATTGGAAGCTA
rJMSF010F11+ CGCTCTCGAGGTCACTAAAGAAGATCAATCTAGCAACAGCGGCAACAACATTGGAAGCTA
                      ____________________________________________________________
consensus CGCTCTCGAGGTCACTAAAGAAGATCAATCTAGCAACAGCGGCAACAACATTGGAAGCTA
 
. : . : . : . : . : . :
rJMSF037D22+ AGGTAAGAACCAAGTTCCATGTAAATTTTTGCCGATAAATACCTGGAACATGGCATCATC
rJMSF010F11+ AGGTAAGAACCAAGTTCCATGTAAATTTTTGCCGATAAATACCTGGAACATGGCATCATC
                      ____________________________________________________________
consensus AGGTAAGAACCAAGTTCCATGTAAATTTTTGCCGATAAATACCTGGAACATGGCATCATC
 
. : . : . : . : . : . :
rJMSF037D22+ TTGCTCTCAACTAACTATTAGTGGCCAGTCGCCACCATTGTTGTCTGAAAGTATGCTCAC
rJMSF010F11+ TTGCTCTCAACTAACTATTAGTGGCCAGTCGCCACCATTGTTGTCTGAAAGTATGCTCAC
                      ____________________________________________________________
consensus TTGCTCTCAACTAACTATTAGTGGCCAGTCGCCACCATTGTTGTCTGAAAGTATGCTCAC
 
. : . : . : . : . : . :
rJMSF037D22+ GAAACCGACAACAGGAACATCATCATGAAAATGTCATTGAGATATCTGTTGTAAT
rJMSF010F11+ GAAACCGACAACAGGAACATCATCATGAAAATGTCATTGAGATATCTGTTGTAATTGAAC
                      ____________________________________________________________
consensus GAAACCGACAACAGGAACATCATCATGAAAATGTCATTGAGATATCTGTTGTAATTGAAC