Previous Contig 011556:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034F24Sequence516011556 (23)pir|T00555|T005551e-37hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153650011556 (23)pir|T00555|T005553e-76hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF006D18Sequence287018464440011556 (23)pir|T00555|T005556e-46hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF006F20Sequence441011556 (23)pir|T00555|T005553e-28hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153237013726 (4)
JMSF007F20Sequence419011556 (23)pir|T00555|T005553e-25hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153649011556 (23)pir|T00555|T005554e-88hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF009O13Sequence204011556 (23)774011556 (23)pir|T00555|T005551e-92hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF010D15Sequence247011556 (23)768011556 (23)pir|T00555|T005557e-83hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF021F16Sequence708011556 (23)pir|T00555|T005553e-66hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153744011556 (23)pir|T00555|T005556e-87hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF022G19Sequence674011556 (23)pir|T00555|T005551e-65hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153703011556 (23)pir|T00555|T005555e-88hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF024L16Sequence651007772 (25)pir|S68407|S684078e-73ribulose-phosphate 3-epimerase (EC 5.1.3.1) precursor - potato (fragment)708011556 (23)pir|T00555|T005555e-88hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF037H19Sequence667011556 (23)gb:AP003231_18257726e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003679011556 (23)pir|T00555|T005552e-85hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF046K05Sequence638011556 (23)pir|T00555|T005553e-59hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153846011556 (23)pir|T00555|T00555e-108hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF047M08Sequence707011556 (23)pir|T00555|T005555e-71hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153703011556 (23)pir|T00555|T005555e-88hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153
JMSF051O14Sequence669011556 (23)pir|T00555|T005555e-54hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153709011556 (23)pir|T00555|T005555e-88hypothetical protein At2g39450 [imported] - Arabidopsis thaliana>gb:AC004218_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009O13- CTCCCCTCCCTCCCTCTC
JMSF010D15- GGCTCTCCCCTCCCTCCCTCTC
JMSF051O14- CTCTCCCCTCCCTCCCTCTC
JMSF037H19- CTCTCCCCTCCCTCCCTCTC
JMFF034F24- CCCTCTC
JMSF021F16- CTCTCCCCTCCCTCCCTCTC
                      ____________________________________________________________
consensus GGCTCTCCCCTCCCTCCCTCTC
 
. : . : . : . : . : . :
JMSF009O13- TCTCTCTCTCGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF010D15- TCTCTCTCTCGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF046K05- GGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF022G19- GGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF051O14- TCTCTCTCTCGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF037H19- TCTCTCTCTCGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMFF034F24- TCTCTCTCTCGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF007F20- GGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF006F20- GGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF021F16- TCTCTCTCTCGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
JMSF047M08- GGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
                      ____________________________________________________________
consensus TCTCTCTCTCGCTCGCTCGCAGTAGTCCGCAGAGCCGGGCCAGCACTCCGCCGCGATTCG
 
. : . : . : . : . : . :
JMSF009O13- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF010D15- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF046K05- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF022G19- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF051O14- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF037H19- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMFF034F24- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF007F20- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF006F20- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF021F16- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
JMSF047M08- CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
                      ____________________________________________________________
consensus CGAAGGCTTCTGGAGGAGTAGGGTTTCGTCCGTACTGCTGCGACGCAGCAATCCGAAAAT
 
. : . : . : . : . : . :
JMSF009O13- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAAGAGCACCTCCTGCTGGC
JMSF010D15- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAAGAGCACCTCCTGCTGGC
JMSF046K05- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMSF022G19- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMSF051O14- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMSF037H19- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMFF034F24- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMSF007F20- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMSF006F20- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMSF021F16- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
JMSF047M08- GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
                      ____________________________________________________________
consensus GGTGGAGACGGTTAGCCTCGACGTCGATCGCGGTGGCTCCGAGGAGCACCTCCTGCTGGC
 
. : . : . : . : . : . :
JMSF009O13- GGCGG
JMSF010D15- GGCGGANGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTC
JMSF046K05- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMSF022G19- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMSF051O14- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMSF037H19- GGCGGAGGCTAGCAAGAC--ACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMFF034F24- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMSF007F20- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMSF006F20- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMSF021F16- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
JMSF047M08- GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
                      ____________________________________________________________
consensus GGCGGAGGCTAGCAAGACTGACTGCTCCTGGAGGTTGAACTTCGACGGGTTCGAGTTGTC
 
. : . : . : . : . : . :
JMSF046K05- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMSF022G19- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMSF051O14- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMSF037H19- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMFF034F24- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMSF007F20- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMSF006F20- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMSF021F16- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
JMSF047M08- GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
                      ____________________________________________________________
consensus GGCGGAGCACAAGGAGAAGCCTCCTCGCGGCCTCCATGACTGCCTTGGGGTTTTAAGAGA
 
. : . : . : . : . : . :
JMSF046K05- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMSF022G19- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMSF051O14- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMSF037H19- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMFF034F24- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMSF007F20- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMSF006F20- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMSF021F16- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
JMSF047M08- AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
                      ____________________________________________________________
consensus AGAAGATATTGTGGCAGAGTATTATCAACAACAGGTAGAAATGCTTGAGGGATTTAATGA
 
. : . : . : . : . : . :
JMSF046K05- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMSF022G19- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMSF051O14- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMSF037H19- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMFF034F24- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMSF007F20- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMSF006F20- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMSF021F16- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
JMSF047M08- AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
                      ____________________________________________________________
consensus AATGGATGCCTTAGCAGATCGTGGTTTTGTGCCAGGAATGTCAAAGGAAGAAAGGGAAAA
 
. : . : . : . : . : . :
JMSF046K05- GTTGGCCAAAAGTGAGACAGCTGCCATAAGGATATCAAATGTTGCAAACATGGTTCTCTT
JMSF022G19- GTTGGCCAAAAGTGAGACAGCTGCCATAAGGATATCAAATGTTGCAAACATGGTTCTCTT
JMSF051O14- GTTGGCCAAAAGTGAGACAGCTGCCAT-AGGATATCAAATGTTGCAAACATGGTTCTCTT
JMSF037H19- GTTGGCCAAAAGTGAGACAGCTGCCATAAGGATATCAAATGTTGCAAACATGGTTCTCTT
JMFF034F24- GTTGGCCAAAAGTGAGACAGCTGCCATAAGGATATCAAATGTTGCAAACATGGNTCTCTT
JMSF007F20- GTTGGCCA
JMSF006F20- GTTGGCCAAAAGTGAGACAGCTGCCATAAG
JMSF021F16- GTTGGCCAAAAGTGAGACAGCTGCCATAAGGATATCAAATGTTGCAAACATGGTTCTCTT
JMSF047M08- GTTGGCCAAAAGTGAGACAGCTGCCATAAGGATATCAAATGTTGCAAACATGGTTCTCTT
                      ____________________________________________________________
consensus GTTGGCCAAAAGTGAGACAGCTGCCATAAGGATATCAAATGTTGCAAACATGGTTCTCTT
 
. : . : . : . : . : . :
JMSF046K05- TGCTGCTAAGGTTTATGCATCTATACAGAGTGGGTCACTGGCCATCATTGCATCCACATT
JMSF022G19- TGCTGCTAAGGTTTATGCATCTATACAGAGTGGGTCACTGGCCATCATTGCATCCACATT
JMSF051O14- TGCTGCTAAGGTTTATGCATCTATACAGAGTGGGTCACTGGCCATCATTGCATCCACATT
JMSF037H19- TGCTGCTAAGGTTTATGCATCTATACAGAGTGGGTCACTGGCCATCATTGCATCCACATT
JMFF034F24- TGCTGCTAAGGTTTATGCATCTATACAGA
JMSF021F16- TGCTGCTAAGGTTTATGCATCTATACAGAGTGGGTCACTGGCCATCATTGCATCCACATT
JMSF047M08- TGCTGCTAAGGTTTATGCATCTATACAGAGTGGGTCACTGGCCATCATTGCATCCACATT
                      ____________________________________________________________
consensus TGCTGCTAAGGTTTATGCATCTATACAGAGTGGGTCACTGGCCATCATTGCATCCACATT
 
. : . : . : . : . : . :
JMSF046K05- AGACTCTCTGCTTGATCTTCTCTCTGGTTTTATTTTGTGGTTTACGGCTTTCTCCATGCA
JMSF022G19- AGACTCTCTGCTTGATCTTCTCTCTGGTTTTATTTTGTGGTTTACGGCTTTCTCCATGCA
JMSF051O14- AGACTCTCTGCTTGATCTTCTCTCTGGTTTTATTTTGTGGTTTACGGCTTTCTCCATGCA
JMSF037H19- AGACTCTCTGCTTGATCTTCTCTCTGGTTTTATTTTGTGGTTTACGGCTTTCTCCATGCA
JMSF021F16- AGACTCTCTGCTTGATCTTCTCTCTGGTTTTATTTTGTGGTTTACGGCTTTCTCCATGCA
JMSF047M08- AGACTCTCTGCTTGATCTTCTCTCTGGTTTTATTTTGTGGTTTACGGCTTTCTCCATGCA
rJMSF046K05+ TCCATGCA
                      ____________________________________________________________
consensus AGACTCTCTGCTTGATCTTCTCTCTGGTTTTATTTTGTGGTTTACGGCTTTCTCCATGCA
 
. : . : . : . : . : . :
JMSF046K05- GACACCAAATCCATATCAATATCCAATTGGAAAGAAACGTATGCAGC
JMSF022G19- GACACCAAATCCATATCAATATCCAATTGGAAAGAAACGTATGCAGCC-TTTGGGAATCC
JMSF051O14- GACACCAAATCCATATCAATATCCAATTGGAAAGAAACGTATGCAGCC
JMSF037H19- GACACCAAATCCATATCAATATCCAATTGGAAAGAAACGTATGCAGC
JMSF021F16- GACACCAAATCCATATCAATATCCAATTGGAAAGAAACGTATGCAGCC-TTTGGGAATCC
JMSF047M08- GACACCAAATCCATATCAATATCCAATTGGAAAGAAACGTATGCAGCC-TTTGGGAATCC
rJMSF046K05+ GACACCNAATCCATATCNATATCCAATTGGAAAGAAACGTATGCAGCCTTTTGGGAATCC
                      ____________________________________________________________
consensus GACACCAAATCCATATCAATATCCAATTGGAAAGAAACGTATGCAGCC-TTTGGGAATCC
 
. : . : . : . : . : . :
JMSF022G19- TTGTTTTTGCTTCTGTGATGGCGA
JMSF021F16- TTGTTTTTGCTTCTGTGATGGCGA
JMSF047M08- TTGTTTTTGCTTCTGTGATGGCGACCTTAGGACTGCAGATAATTTTGGAATCTGTGC
rJMSF046K05+ TTGTTTTTGCTTCTGTGATGGCGACCTTAGGACTGCAGATAATTTTGGAATCTGTGCGCA
rJMSF021F16+ TGCAGATAATTTTGGAATCTGTGCGCA
rJMSF009O13+ TGCAGATAATTTTGGAATCTGTGCGCA
                      ____________________________________________________________
consensus TTGTTTTTGCTTCTGTGATGGCGACCTTAGGACTGCAGATAATTTTGGAATCTGTGCGCA
 
. : . : . : . : . : . :
rJMSF046K05+ CTCTTATATCTGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF021F16+ CTCTTATATCTGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF051O14+ TGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF024L16+ TGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF022G19+ TGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF047M08+ TGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF037H19+ AATGAACAGGAGCGATGGGTTGTTG
rJMSF007F20+ TGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF009O13+ CTCTTATATNTGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
rJMSF010D15+ TGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
                      ____________________________________________________________
consensus CTCTTATATCTGAGGAGGCAGATTTCAACCTCACCAATGAACAGGAGCGATGGGTTGTTG
 
. : . : . : . : . : . :
rJMSF046K05+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF021F16+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF051O14+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF024L16+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF022G19+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF047M08+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF037H19+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMFF034F24+ TGGTGTTTTATTGTCGATCCTTCA
rJMSF007F20+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF009O13+ GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
rJMSF010D15+ GCATAATGA-TTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
                      ____________________________________________________________
consensus GCATAATGATTTTTGTCACTCTGGTGAAACTGGTTTTGGTGTTTTATTGTCGATCCTTCA
 
. : . : . : . : . : . :
rJMSF046K05+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF021F16+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF051O14+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF024L16+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF022G19+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF047M08+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF037H19+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMFF034F24+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF007F20+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF009O13+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
rJMSF010D15+ CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
                      ____________________________________________________________
consensus CCAATGAAATTGTCAAGGCATATGCCCAGGATCACTTCTTTGATGTTGTCACTAACATCA
 
. : . : . : . : . : . :
rJMSF046K05+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF021F16+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF051O14+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF024L16+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF022G19+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF047M08+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF037H19+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMFF034F24+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF007F20+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF009O13+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
rJMSF010D15+ TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
                      ____________________________________________________________
consensus TAGGCCTTGTTGCTGCATTACTTGCAAACTACATAACTGGCTGGATTGATCCTGTTGGAG
 
. : . : . : . : . : . :
rJMSF046K05+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF021F16+ CTATTATTCT--CTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF051O14+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF024L16+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF022G19+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF047M08+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF037H19+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF006D18+ ACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMFF034F24+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF007F20+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF009O13+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
rJMSF010D15+ CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
                      ____________________________________________________________
consensus CTATTATTCTGGCTTTGTACACAATCCGAACATGGTCAATGACAGTGCTGGAGAACGTGA
 
. : . : . : . : . : . :
rJMSF046K05+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF021F16+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF051O14+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF024L16+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF022G19+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF047M08+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF037H19+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF006D18+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMFF034F24+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF007F20+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF009O13+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
rJMSF010D15+ ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
                      ____________________________________________________________
consensus ACTCTCTCGTTGGCAAATCAGCCACACCAGAGTTTCTACAGAAGCTGACATACCTGTGTT
 
. : . : . : . : . : . :
rJMSF046K05+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF021F16+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF051O14+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF024L16+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF022G19+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF047M08+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF037H19+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF006D18+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMFF034F24+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF007F20+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF009O13+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
rJMSF010D15+ GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
                      ____________________________________________________________
consensus GGAATCACCACAAGTCCATAAGGCACATAGACACCGTCAGGGCTTACACCTTCGGCTCTC
 
. : . : . : . : . : . :
rJMSF046K05+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF021F16+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF051O14+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF024L16+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF022G19+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF047M08+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF037H19+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF006D18+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMFF034F24+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF007F20+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF009O13+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
rJMSF010D15+ ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
                      ____________________________________________________________
consensus ACTACTTTGTCGAAGTTGACATAGTCTTGCCTGCAGACATGCCCTTGCAAGAGGCTCATG
 
. : . : . : . : . : . :
rJMSF046K05+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF021F16+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF051O14+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF024L16+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF022G19+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF047M08+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF037H19+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF006D18+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMFF034F24+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF007F20+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF009O13+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
rJMSF010D15+ ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
                      ____________________________________________________________
consensus ACATCGGAGAATCCTTGCAGGAGAAACTGGAACTGCTGCAAGAGATCGAGCGCGCCTTTG
 
. : . : . : . : . : . :
rJMSF046K05+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF021F16+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF051O14+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF024L16+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF022G19+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF047M08+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF037H19+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF006D18+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMFF034F24+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF007F20+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF009O13+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
rJMSF010D15+ TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
                      ____________________________________________________________
consensus TTCACTTGGATTATGAGTACAGCCACAAACCAGAACATGCACAGGCACATCAGTAGATAC
 
. : . : . : . : . : . :
rJMSF046K05+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF021F16+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF051O14+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF024L16+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF022G19+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF047M08+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF037H19+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF006D18+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMFF034F24+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF007F20+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTNNCCGGTGGTT
rJMSF009O13+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
rJMSF010D15+ TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
                      ____________________________________________________________
consensus TGTAAGTAACTTTTATGTGACTTTCTACTCTCCCCCTCATGTCTTTTTTCCGGTGGTTTT
 
. : . : . : . : . : . :
rJMSF046K05+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTT
rJMSF021F16+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTT
rJMSF051O14+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTT
rJMSF024L16+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTT
rJMSF022G19+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCAT
rJMSF047M08+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCAT
rJMSF037H19+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATT
rJMSF006D18+ TAACTGTAATTGATGGGGATTGTATTTTCACCTGGGTAGGCTCCAATTT
rJMFF034F24+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTTT
rJMSF009O13+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTTT
rJMSF010D15+ TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTTT
                      ____________________________________________________________
consensus TAACTGTAATTGATGGGGATTGTATTTTCA-CTGGGTAGGCTCCAATTTGTCATTTCTTT
 
. : . : . : . : . : . :
rJMFF034F24+ GACAGCCTACAAACACTTTAATTATGC
rJMSF009O13+ GACAGCCTACAAACACTTTAATTATGC
rJMSF010D15+ GACAGCCTACAAACACTTTAATTATGCTTGATTCTTATTTTTGCCAATTGGTTTCTATAT
                      ____________________________________________________________
consensus GACAGCCTACAAACACTTTAATTATGCTTGATTCTTATTTTTGCCAATTGGTTTCTATAT