Previous Contig 011554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010C20Sequence350005135 (2)786011554 (2)gb:AP004791_18451445e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P049
JMSF034A18Sequence718005135 (2)723011554 (2)gb:AP004791_18451443e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P049

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010C20+ AAAAGGA
                      ____________________________________________________________
consensus AAAAGGA
 
. : . : . : . : . : . :
rJMSF034A18+ GTTAGACGT
rJMSF010C20+ AAGACGGTCTATGCCCCTGACTCCCGAGGAAACCGCCCTTGCACTAAGGGCGTTAGACGT
                      ____________________________________________________________
consensus AAGACGGTCTATGCCCCTGACTCCCGAGGAAACCGCCCTTGCACTAAGGGCGTTAGACGT
 
. : . : . : . : . : . :
rJMSF034A18+ TGATCCGAGTATCCAAATTTACATTGCTGCCGGAGAGATATATGGAGGAGAGCGAAGAAT
rJMSF010C20+ TGATCCGAGTATCCAAATTTACATTGCTGCCGGAGAGATATATGGAGGAGAGCGAAGAAT
                      ____________________________________________________________
consensus TGATCCGAGTATCCAAATTTACATTGCTGCCGGAGAGATATATGGAGGAGAGCGAAGAAT
 
. : . : . : . : . : . :
rJMSF034A18+ GGCTAGTCTAGCAGCATCTTATCCAAACCTGGTTAGAAAGGAGACACTATTGGATCCTTC
rJMSF010C20+ GGCTAGTCTAGCAGCATCTTATCCAAACCTGGTTAGAAAGGAGACACTATTGGATCCTTC
                      ____________________________________________________________
consensus GGCTAGTCTAGCAGCATCTTATCCAAACCTGGTTAGAAAGGAGACACTATTGGATCCTTC
 
. : . : . : . : . : . :
rJMSF034A18+ CGATCTTAGGTTCTTTCAAAACCACTCATCCCAGATGGCTGCATTAGACTATCTTGTTTC
rJMSF010C20+ CGATCTTAGGTTCTTTCAAAACCACTCATCCCAGATGGCTGCATTAGACTATCTTGTTTC
                      ____________________________________________________________
consensus CGATCTTAGGTTCTTTCAAAACCACTCATCCCAGATGGCTGCATTAGACTATCTTGTTTC
 
. : . : . : . : . : . :
rJMSF034A18+ ACTTGAGAGTGATATATTCGTACCTACATACGATGGAAACATGGCAAAAGTTGTCGAGGG
rJMSF010C20+ ACTTGAGAGTGATATATTCGTACCTACATACGATGGAAACATGGCAAAAGTTGTCGAGGG
                      ____________________________________________________________
consensus ACTTGAGAGTGATATATTCGTACCTACATACGATGGAAACATGGCAAAAGTTGTCGAGGG
 
. : . : . : . : . : . :
rJMSF034A18+ TCATCGCAGATATCTCGAATACAAGAAGACGATCCTTTTGGACAGAAGGCTTCTGGTGGA
rJMSF010C20+ TCATCGCAGATATCTCGAATACAAGAAGACGATCCTTTTGGACAGAAGGCTTCTGGTGGA
                      ____________________________________________________________
consensus TCATCGCAGATATCTCGAATACAAGAAGACGATCCTTTTGGACAGAAGGCTTCTGGTGGA
 
. : . : . : . : . : . :
rJMSF034A18+ TCTGATAGACCAGTATATCGGTGAATCATTAACGTGGGATGAGTTCTCTAACGCTGTTAA
rJMSF010C20+ TCTGATAGACCAGTATATCGGTGAATCATTAACGTGGGATGAGTTCTCTAACGCTGTTAA
                      ____________________________________________________________
consensus TCTGATAGACCAGTATATCGGTGAATCATTAACGTGGGATGAGTTCTCTAACGCTGTTAA
 
. : . : . : . : . : . :
rJMSF034A18+ GGCAGCTCACGCTGATCACATGGGGAACCCCGCTAAAAGGTTGGTCATTCCGGACCGACC
rJMSF010C20+ GGCAGCTCACGCTGATCACATGGGGAACCCCGCTAAAAGGTTGGTCATTCCGGACCGACC
                      ____________________________________________________________
consensus GGCAGCTCACGCTGATCACATGGGGAACCCCGCTAAAAGGTTGGTCATTCCGGACCGACC
 
. : . : . : . : . : . :
rJMSF034A18+ CAAGGAAGAGGATTACTTCTACTCCAACCCTTGGGAGTGTTTACAGCCATCAAACGAGGA
rJMSF010C20+ CAAGGAAGAGGATTACTTCTACTCCAACCCTTGGGAGTGTTTACAGCCATCAAACGAGGA
                      ____________________________________________________________
consensus CAAGGAAGAGGATTACTTCTACTCCAACCCTTGGGAGTGTTTACAGCCATCAAACGAGGA
 
. : . : . : . : . : . :
rJMSF034A18+ TGGAGCGTTAAGTAGTAGCAGTAGTATCTAAATCACGGGGGCAGTAGCATACACGTTTAT
rJMSF010C20+ TGGAGCGTTAAGTAGTAGCAGTAGTATCTAAATCACGGGGGCAGTAGCATACACGTTTAT
                      ____________________________________________________________
consensus TGGAGCGTTAAGTAGTAGCAGTAGTATCTAAATCACGGGGGCAGTAGCATACACGTTTAT
 
. : . : . : . : . : . :
rJMSF034A18+ ATAAATTTAGTAATCGAAATTCATGTATAGAAGCCCTGCCATTGAAGGGTTATATCAACT
rJMSF010C20+ ATAAATTTAGTAATCGAAATTCATGTATAGAAGCCCTGCCATTGAAGGGTTATATCAACT
                      ____________________________________________________________
consensus ATAAATTTAGTAATCGAAATTCATGTATAGAAGCCCTGCCATTGAAGGGTTATATCAACT
 
. : . : . : . : . : . :
rJMSF034A18+ GCAGTGTACACAACATAGATTTTGTTTCATTGGAAGCAAAGGTTGTCTGTTTGTCAGCTT
rJMSF010C20+ GCAGTGTACACAACATAGATTTTGTTTCATTGGAAGCAAAGGTTGTCTGTTTGTCAGCTT
                      ____________________________________________________________
consensus GCAGTGTACACAACATAGATTTTGTTTCATTGGAAGCAAAGGTTGTCTGTTTGTCAGCTT
 
. : . : . : . : . : . :
rJMSF034A18+ CACGCCTTTCCTCGTCTAGTATCTGATATATATGTATAGCAGCCCCATTATGT
rJMSF010C20+ CACGCCTTTCCTCGTCTAGTATCT-ATATATATGTATAGCAGCCCCATTATGTTGTAACA
                      ____________________________________________________________
consensus CACGCCTTTCCTCGTCTAGTATCTGATATATATGTATAGCAGCCCCATTATGTTGTAACA