Previous Contig 011551:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010C03Sequence298008113 (3)755011551 (2)gb:NTA416572_16913977e-37Nicotiana tabacum partial nictaRpoT1-syl gene for mitochondrial RNA polymerase,
JMSF052H19Sequence654008113 (3)sp|Q93Y94|RPO1_NICSY3e-23DNA-directed RNA polymerase 1, mitochondrial precursor (EC 2.7.7.6) (T7 bacterio834011551 (2)gb:NSY416568_16912301e-54Nicotiana sylvestris mRNA for mitochondrial RNA polymerase (rpoT1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052H19+ AANCAGATAAGGT
                      ____________________________________________________________
consensus AANCAGATAAGGT
 
. : . : . : . : . : . :
rJMSF052H19+ GATGGTCCAGAGGCAGAAGACGGCCTTCCCTCCAAATTTTGTTCACTCACTCGACGGTTC
                      ____________________________________________________________
consensus GATGGTCCAGAGGCAGAAGACGGCCTTCCCTCCAAATTTTGTTCACTCACTCGACGGTTC
 
. : . : . : . : . : . :
rJMSF052H19+ CCATATGATGATGACTGCCATTGCATGCAAAGAAGCGGGCTTAAATTTTGCAGGTGTGCA
rJMSF010C03+ ATGCAAAGAAGCGGGCTTAAATTTTGCAGGTGTGCA
                      ____________________________________________________________
consensus CCATATGATGATGACTGCCATTGCATGCAAAGAAGCGGGCTTAAATTTTGCAGGTGTGCA
 
. : . : . : . : . : . :
rJMSF052H19+ TGATTCGTACTGGACTCATGCATCTGATGTTGATCAAATGAATAGAATTCTGAGGGAAAA
rJMSF010C03+ TGATTCGTACTGGACTCATGCATCTGATGTTGATCAAATGAATAGAATTCTGAGGGAAAA
                      ____________________________________________________________
consensus TGATTCGTACTGGACTCATGCATCTGATGTTGATCAAATGAATAGAATTCTGAGGGAAAA
 
. : . : . : . : . : . :
rJMSF052H19+ GTTTGTCGAACTCTATGAAGCACCAATACTCGAAAATCTATCAGAAAGTTTTCAAAAGTC
rJMSF010C03+ GTTTGTCGAACTCTATGAAGCACCAATACTCGAAAATCTATCAGAAAGTTTTCAAAAGTC
                      ____________________________________________________________
consensus GTTTGTCGAACTCTATGAAGCACCAATACTCGAAAATCTATCAGAAAGTTTTCAAAAGTC
 
. : . : . : . : . : . :
rJMSF052H19+ ATTCCCTAAACTACGATTCCCTCCCTTGCCTGAGCGGGGTGATTTTGACTTGAGAGAAGT
rJMSF010C03+ ATTCCCTAAACTACGATTCCCTCCCTTGCCTGAGCGGGGTGATTTTGACTTGAGAGAAGT
                      ____________________________________________________________
consensus ATTCCCTAAACTACGATTCCCTCCCTTGCCTGAGCGGGGTGATTTTGACTTGAGAGAAGT
 
. : . : . : . : . : . :
rJMSF052H19+ TCTGGATTCTCCGTACTTTTTCAACTAGATCAACGGTCATTCATTTTGGAAATTTTGGGC
rJMSF010C03+ TCTGGATTCTCCGTACTTTTTCAACTAGATCAACGGTCATTCATTTTGGAAATTTTGGGC
                      ____________________________________________________________
consensus TCTGGATTCTCCGTACTTTTTCAACTAGATCAACGGTCATTCATTTTGGAAATTTTGGGC
 
. : . : . : . : . : . :
rJMSF052H19+ TACCATAAGAAAGTTTGGAATAAGATATACATCGCCCACCAACTCCGTGGTCAAAATTGC
rJMSF010C03+ TACCATAAGAAAGTTTGGAATAAGATATACATCGCCCACCAACTCCGTGGTCAAAATGGC
                      ____________________________________________________________
consensus TACCATAAGAAAGTTTGGAATAAGATATACATCGCCCACCAACTCCGTGGTCAAAATTGC
 
. : . : . : . : . : . :
rJMSF052H19+ CATTGCAATCGAGGTGTGTAGCCAATCATTTGACTGTGCTCCATAGATGACCCTTCAACA
rJMSF010C03+ CATTGCAATCGAGGTGTGTAGCCAATCATTTGACTGTGCTCCATAGATGACCCTTCAACA
                      ____________________________________________________________
consensus CATTGCAATCGAGGTGTGTAGCCAATCATTTGACTGTGCTCCATAGATGACCCTTCAACA
 
. : . : . : . : . : . :
rJMSF052H19+ TGAGCCCATTGATCATCTCGAGCTATAGACTTAAAGCACGCTAACTATACAGGAAGTTTG
rJMSF010C03+ TGAGCCCATTGATCATCTCGAGCTATAGACTTAAAGCACGCTAACTATACAGGAAGTTTG
                      ____________________________________________________________
consensus TGAGCCCATTGATCATCTCGAGCTATAGACTTAAAGCACGCTAACTATACAGGAAGTTTG
 
. : . : . : . : . : . :
rJMSF052H19+ GAATGTGAAGACGACACGACTAATCTTAAACCTGTCATACATTTGAAAGCTGGGGAGACA
rJMSF010C03+ GAATGTGAAGACGACACGACTAATCTTAAACCTGTCATACATTTGAAAGCTGGGGAGACA
                      ____________________________________________________________
consensus GAATGTGAAGACGACACGACTAATCTTAAACCTGTCATACATTTGAAAGCTGGGGAGACA
 
. : . : . : . : . : . :
rJMSF052H19+ TCTCCAATGTCGTTCCTATACGCATATAATGCAGTGAGGAGAAGCATTTGCTTATTTTGA
rJMSF010C03+ TCTCCAATGTCGTTCCTATACGCATATAATGCAGTGAGGAGAAGCATTTGCTTATTTTGA
                      ____________________________________________________________
consensus TCTCCAATGTCGTTCCTATACGCATATAATGCAGTGAGGAGAAGCATTTGCTTATTTTGA
 
. : . : . : . : . : . :
rJMSF052H19+ GTCTGGAAACCTTGTATAGTCATATGGATAAAAACACACTGCTGTGTGTATATATTTCAG
rJMSF010C03+ GTCTGGAAACCTTGTATAGTCATATGGATAAAAACACACTGCTGTGTGTATATATTTCAG
                      ____________________________________________________________
consensus GTCTGGAAACCTTGTATAGTCATATGGATAAAAACACACTGCTGTGTGTATATATTTCAG
 
. : . : . : . : . : . :
rJMSF052H19+ GTTTTTATTTTTTCTTTTCCAATTTAGTTTCACATTTTCACCTGATTTTTTTTTAATGTA
rJMSF010C03+ GTTTTTATTTTTTCTTTTCCAATTTAGTTTCACATTTTCACCTGATTTTTTTTTAATGTA
                      ____________________________________________________________
consensus GTTTTTATTTTTTCTTTTCCAATTTAGTTTCACATTTTCACCTGATTTTTTTTTAATGTA
 
. : . : . : . : . : . :
rJMSF052H19+ NATAGCANCCAGCTGATAGNTGTGATANTNGTCATCCATAT
rJMSF010C03+ NATAGCANCCAGCTGATAG-TGTGATAATAGTCATCCATATNCAATTTGNATCTCTGATA
                      ____________________________________________________________
consensus NATAGCANCCAGCTGATAGNTGTGATAATAGTCATCCATATNCAATTTGNATCTCTGATA